Sequence 1130(siSMAD2.2)
From Wikisequences
Sequence siSMAD2.2 | |
---|---|
Target | SMAD2 (Homo sapiens) |
Description | SMAD family member 2
Ensembl: ENSG00000175387 UniGene: Hs.12253 EntrezGene: 4087 Ensembl Chr18: 43613464 - 43710924 Strand: -1 GO terms: 0001707 0003690 0005622 0005634 0005667 0005737 0006350 0006355 0007179 0007242 0008134 0009952 0016563 0045165 0045944 0048340 0051098 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) ACTAGAATGTGCACCATAATT / siRNA antisense (21b) TTATGGTGCACATTCTAGTTA |
Application | gene silencing |
Name | siSMAD2.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478