Sequence 1138(hCAP-C (RC-2) , hCAPC (RC2) )

Sequence hCAP-C (RC-2) , hCAPC (RC2)
Target	SMC4 ( Homo sapiens )
Description	Structural maintenance of chromosomes 4 Ensembl: ENSG00000113810 UniGene: Hs.58992 EntrezGene: 10051 Ensembl Chr3: 161600124 - 161635433 Strand: 1 GO terms: 0000166 0000796 0005515 0005524 0005634 0005694 0005737 0006259 0007001 0007049 0007076 0017111 0046982 0051276 0051301
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GGATGTTGGAAATCTTCTTTT / siRNA antisense (21b) AAGAAGATTTCCAACATCCTT
Application	gene silencing
Name	hCAP-C (RC-2) , hCAPC (RC2)

References

Spatial and temporal regulation of Condensins I and II in mitotic chromosome assembly in human cells.Ono T, Fang Y, Spector DL, Hirano T.Mol Biol Cell. 2004 Jul;15(7) :3296-308. Epub 2004 May 14.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Members of the structural maintenance of chromosomes, or SMC, family (e.g., SMC1A; 300040) are critical for mitotic chromosome condensation in frogs and for DNA repair in mammals.Gene Function. By coimmunoprecipitation and Western blot analysis of HeLa cell nuclear extract, Schmiesing et al. (2000) found that CAPC and CAPE (SMC2) interacted with CNAP1 (NCAPD2; 615638) in a stoichiometric manner. In synchronized HeLa cells, the 3 condensin proteins localized to the cytoplasm during interphase, but a subpopulation of the complex colocalized at specific chromosomal foci. During late G2/early prophase, these foci colocalized with phosphorylated histone H3 (see 602810) and, like phosphorylated histone H3, the condensin foci grew to cover the entire length of chromosomes during mitosis. Following mitosis, the majority of condensin subunits relocalized to the cytoplasm.