Sequence 1139(SMG6)

Sequence SMG6
Target	SMG6 ( Homo sapiens )
Description	Smg-6 homolog, nonsense mediated mRNA decay factor ( C. elegans ) Ensembl: ENSG00000070366 UniGene: Hs.448342 EntrezGene: 23293 Ensembl Chr17: 1909883 - 2153819 Strand: -1 GO terms: 0000184 0000723 0000781 0003677 0004519 0005515 0005634 0005694 0005697 0005737 0006406 0016787 0030145 0035303 0042162 0046872
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) AAGCCAGTGATACAGCGAATT / siRNA antisense (21b) TTCGCTGTATCACTGGCTTTT
Application	gene silencing
Name	SMG6

References

SMG7 acts as a molecular link between mRNA surveillance and mRNA decay.Unterholzner L, Izaurralde E.Mol Cell. 2004 Nov 19;16(4) :587-96.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. SMG6 is involved in nonsense-mediated mRNA decay (Fukuhara et al., 2005). Gene Function. Snow et al. (2003) found that EST1A associated with telomerase activity in human cell lines and bound human TERT (187270) in rabbit reticulocyte lysates. In contrast to yeast Est1, EST1A bound TERT independently of telomerase RNA (TERC; 602322). An N-terminal region of EST1A bound yeast telomeric single-stranded DNA and, more weakly, human telomeric DNA. Transfection of human embryonic kidney cells with EST1A led to decreased average telomere length, whereas cotransfection of EST1A with TERT resulted in telomere lengths that exceeded those of cells expressing TERT alone. Transfection of EST1A with or without TERT in telomerase-negative cells resulted in no change in telomere length.

Using pull-down assays, Fukuhara et al. (2005) showed that the 14-3-3-zeta-like domain of recombinant SMG6 bound to in vitro translated UPF1. Binding was impaired by mutations in the phosphoserine-binding site of SMG6.

Azzalin et al. (2007) demonstrated that mammalian telomeres are transcribed into telomeric repeat-containing RNA (TERRA). TERRA molecules are heterogeneous in length, are transcribed from several subtelomeric loci toward chromosome ends, and localize to telomeres. Azzalin et al. (2007) also showed that suppressors with morphogenic defects in genitalia (SMG) proteins, which are effectors of nonsense-mediated mRNA decay, are enriched at telomeres in vivo, negatively regulate TERRA association with chromatin, and protect chromosome ends from telomere loss. Thus, Azzalin et al. (2007) concluded that telomeres are actively transcribed into TERRA, and SMG factors represent a molecular link between TERRA regulation and the maintenance of telomere integrity.