Sequence 1143(SOCS3)

From Wikisequences
Jump to: navigation, search
Sequence SOCS3
Target Socs3 ( Mus musculus )
Description Suppressor of cytokine signaling 3

Ensembl: ENSMUSG00000053113 UniGene: Mm.3468 EntrezGene: 12702 Ensembl Chr11: 117827403 - 117830500 Strand: -1 GO terms: 0001558 0001932 0005515 0007242 0046627

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) GGAGCAAAAGGGTCAGAGGTT / siRNA antisense (21b) CCTCTGACCCTTTTGCTCCTT
Application gene silencing
Name SOCS3

References

Cutting edge: silencing suppressor of cytokine signaling 3 expression in dendritic cells turns CD28-Ig from immune adjuvant to suppressant.Orabona C, Belladonna ML, Vacca C, Bianchi R, Fallarino F, Volpi C, Gizzi S, Fioretti MC, Grohmann U, Puccetti P.J Immunol. 2005 Jun 1;174(11) :6582-6. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders