Sequence 1143(SOCS3)
From Wikisequences
Sequence SOCS3 | |
---|---|
Target | Socs3 ( Mus musculus ) |
Description | Suppressor of cytokine signaling 3
Ensembl: ENSMUSG00000053113 UniGene: Mm.3468 EntrezGene: 12702 Ensembl Chr11: 117827403 - 117830500 Strand: -1 GO terms: 0001558 0001932 0005515 0007242 0046627 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGAGCAAAAGGGTCAGAGGTT / siRNA antisense (21b) CCTCTGACCCTTTTGCTCCTT |
Application | gene silencing |
Name | SOCS3 |
References
Cutting edge: silencing suppressor of cytokine signaling 3 expression in dendritic cells turns CD28-Ig from immune adjuvant to suppressant.Orabona C, Belladonna ML, Vacca C, Bianchi R, Fallarino F, Volpi C, Gizzi S, Fioretti MC, Grohmann U, Puccetti P.J Immunol. 2005 Jun 1;174(11) :6582-6.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
