Sequence 1174(siSTAT3.2)
From Wikisequences
Sequence siSTAT3.2 | |
---|---|
Target | STAT3 (Homo sapiens) |
Description | Signal transducer and activator of transcription 3 (acute-phase response factor)
Ensembl: ENSG00000168610 UniGene: Hs.463059 EntrezGene: 6774 Ensembl Chr17: 37718869 - 37794039 Strand: -1 GO terms: 0000122 0003700 0004871 0005062 0005509 0005634 0005737 0006355 0006928 0006953 0007165 0007242 0007259 0007399 0008134 0019221 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CGTCATTAGCAGAATCTCATT / siRNA antisense (21b) TGAGATTCTGCTAATGACGTT |
Application | gene silencing |
Name | siSTAT3.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478