Sequence 152 (siAct1-4 , siAct14)

Sequence siAct1-4 , siAct14
Target	AKT1 ( Homo sapiens )
Description	V-akt murine thymoma viral oncogene homolog 1 Ensembl: ENSG00000142208 UniGene: Hs.525622 EntrezGene: 207 Ensembl Chr14: 104306734 - 104333125 Strand: -1 GO terms: 0000060 0000166 0001568 0001890 0004672 0004674 0004713 0005351 0005515 0005524 0005634 0005737 0005819 0005886 0005975 0005977 0005978 0006006 0006417 0006464 0006468 0006809 0006915
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GATGACAGCATGGAGTGTGTT / siRNA antisense (21b) CACACTCCATGCTGTCATCTT
Application	gene silencing
Name	siAct1-4 , siAct14

References

Specificity of short interfering RNA determined through gene expression signatures.Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert DN, Fesik SW.Proc Natl Acad Sci U S A. 2003 May 27;100(11) :6347-52. Epub 2003 May 13.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Phosphoinositide 3-kinases, or PI3Ks (see PIK3CA; 171834), generate specific inositol lipids implicated in the regulation of cell growth, proliferation, survival, differentiation, and cytoskeletal changes. One of the best characterized targets of PI3K lipid products is the protein kinase AKT, or protein kinase B (PKB). In quiescent cells, PKB resides in the cytosol in a low-activity conformation. Upon cellular stimulation, PKB is activated through recruitment to cellular membranes by PI3K lipid products and by phosphorylation by 3-prime phosphoinositide-dependent kinase-1 (PDPK1; 605213). Gene Function. The serine-threonine protein kinase encoded by the AKT1 gene is catalytically inactive in serum-starved primary and immortalized fibroblasts. Franke et al. (1995) showed that AKT1 and the related AKT2 (164731) are activated by platelet-derived growth factor (PDGF; 190040). The activation is rapid and specific, and is abrogated by mutations in the pleckstrin homology domain of AKT1. Other experiments showed that the activation also depends on PDGFRB (173410) tyrosines 740 and 751, which bind PIK3 upon phosphorylation.

Dudek et al. (1997) demonstrated that AKT is important for the survival of cerebellar neurons. Thus, the 'orphan' kinase moved center stage as a crucial regulator of life and death decisions emanating from the cell membrane (Hemmings, 1997). The work of Dudek et al. (1997) delineated a signaling pathway by which insulin-like growth factor-1 (IGF1; 147440) promotes the survival of cerebellar neurons. IGF1 activation of PIK3 triggered the activation of 2 protein kinases, AKT and the p70 ribosomal protein S6 kinase (p70-RPS6K). Experiments with pharmacologic inhibitors, as well as expression of wildtype and dominant-inhibitory forms of AKT, demonstrated that AKT but not p70-RPS6K mediates PIK3-dependent survival. The findings suggested that in the developing nervous system AKT is a critical mediator of growth factor-induced neuronal survival. Franke et al. (1997) defined the specific mechanisms by which lipid products of PIK3 regulate AKT.

Ozes et al. (1999) showed that AKT1 is involved in the activation of NFKB1 (164011) by TNF (191160), following the activation of PIK3. Constitutively active AKT1 induces NFKB1 activity, mediated by phosphorylation of IKBKA (600664) at threonine 23, which can be blocked by activated NIK (604655). Conversely, NIK activation of NFKB, mediated by phosphorylation of IKBKA at serine 176, is blocked by an AKT1 mutant lacking kinase activity (i.e., kinase dead AKT), indicating that both AKT1 and NIK are necessary for TNF activation of NFKB1 through the phosphorylation of IKBKA. IKBKB (IKKB; 603258) is not phosphorylated by either NIK or AKT1 and is apparently differentially regulated.

Most proliferating cells are programmed to undergo apoptosis unless specific survival signals are provided. PDGF promotes cellular proliferation and inhibits apoptosis. Romashkova and Makarov (1999) showed that PDGF activates the RAS/PIK3/AKT1/IKBKA/NFKB1 pathway. In this pathway, NFKB1 does not induce c-myc and apoptosis, but instead induces putative antiapoptotic genes. In response to PDGF, AKT1 transiently associates with IKBK and induces IKBK activation. The authors suggested that under certain conditions PIK3 may activate NFKB1 without the involvement of IKBA (164008) or IKBB (604495) degradation.

Survival factors can suppress apoptosis in a transcription-independent manner by activating the serine/threonine kinase AKT1, which then phosphorylates and inactivates components of the apoptotic machinery, including BAD (603167) and caspase-9 (602234). Brunet et al. (1999) demonstrated that AKT1 also regulates the activity of FKHRL1 (FOXO3A; 602681), a member of the forkhead family of transcription factors. In the presence of survival factors, AKT1 phosphorylates FKHRL1, leading to the association of FKHRL1 with 14-3-3 proteins (see YWHAH, 113508) and its retention in the cytoplasm. Survival factor withdrawal leads to FKHRL1 dephosphorylation, nuclear translocation, and target gene activation. Within the nucleus, FKHRL1 most likely triggers apoptosis by inducing the expression of genes that are critical for cell death, such as the TNFSF6 gene (134638). Animal Model.Holland et al. (2000) transferred, in a tissue-specific manner, genes encoding activated forms of Ras (190070) and Akt to astrocytes and neural progenitors in mice. Holland et al. (2000) found that although neither activated Ras nor Akt alone was sufficient to induce glioblastoma multiforme (GBM; 137800) formation, the combination of activated Ras and Akt induced high-grade gliomas with the histologic features of human GBMs. These tumors appeared to arise after gene transfer to neural progenitors, but not after transfer to differentiated astrocytes. Increased activity of RAS is found in many human GBMs, and Holland et al. (2000) demonstrated that Akt activity is increased in most of these tumors, implying that combined activation of these 2 pathways accurately models the biology of this disease.

By targeted disruption of the Akt1 gene, Chen et al. (2001) created an Akt1-null mouse model. Homozygous mice were viable but smaller than wildtype littermates, and they did not display a diabetic phenotype. Upon exposure to genotoxic stress, their life span was shorter. Chen et al. (2001) found that the Akt1-null mice showed increased spontaneous apoptosis in testes and thymi. They observed an attenuation of spermatogenesis in the Akt1-null male mice, and thymocytes were more sensitive to gamma irradiation and dexamethasone-induced apoptosis. Akt1-null mouse embryo fibroblasts were also more susceptible to apoptosis induced by TNF, anti-Fas (134637), ultraviolet irradiation, and serum withdrawal.

To determine the effects of AKT on cardiac function in vivo, Condorelli et al. (2002) generated a mouse model of cardiac-specific Akt overexpression. Transgenic mice were generated by using the E40K, constitutively active mutant of Akt linked to the rat alpha-myosin heavy chain promoter (160710). The effects of cardiac-selective Akt overexpression were studied by echocardiography, cardiac catheterization, and histologic and biochemical techniques. Akt overexpression produced cardiac hypertrophy at the molecular and histologic levels, with a significant increase in cardiomyocyte cell size and concentric left ventricular hypertrophy. Akt-transgenic mice also showed a remarkable increase in cardiac contractility compared with wildtype controls as demonstrated in an invasive hemodynamic study. Diastolic function was not affected at rest but was impaired during graded dobutamine infusion. Other studies indicated that Akt induced hypertrophy in vivo by activating the GSK3B/GATA4 (600576) pathway. These results demonstrated that Akt regulates cardiomyocyte cell size in vivo and that Akt modulates cardiac contractility in vivo without directly affecting beta-adrenergic receptor (see 109630) signaling capacity.

Kim et al. (2003) found that, in addition to hypertrophy, transgenic mice with cardiac-specific overexpression of active Akt showed enhanced left ventricular function. Isolated ventricular myocytes showed increased contractility, which was associated with increased Ca(2+) transients and Ca(2+) channel currents. The rate of relaxation was also enhanced. Kim et al. (2003) determined that Serca2a protein levels were increased by 6.6-fold in transgenic animals, and inhibitor studies suggested that Serca2a overexpression mediated the enhanced left ventricular function.

Peng et al. (2003) developed Akt1/Akt2 double-knockout (DKO) mice. DKO mice showed severe growth deficiency and died shortly after birth. These mice displayed impaired skin development due to a proliferation defect, skeletal muscle atrophy due to marked decrease in individual muscle cell size, and impaired bone development. The defects were similar to the phenotype of Igf1 receptor (IGF1R; 147370)-deficient mice, suggesting that Akt may serve as an important downstream effector of Igf1r during mouse development. DKO mice also displayed impeded adipogenesis through decreased induction of Pparg (601487).