Sequence 176 (siPHAPI)

Sequence siPHAPI
Target	ANP32A ( Homo sapiens )
Description	Acidic ( leucine-rich ) nuclear phosphoprotein 32 family, member A Ensembl: ENSG00000114026
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GGACGCCCTCTGATGTGAATT / siRNA antisense (21b) TTCACATCAGAGGGCGTCCTT
Application	gene silencing
Name	siPHAPI

References

Protein phosphatase 2A, a negative regulator of the ERK signaling pathway, is activated by tyrosine phosphorylation of putative HLA class II-associated protein I (PHAPI) /pp32 in response to the antiproliferative lectin, jacalin.Yu LG, Packman LC, Weldon M, Hamlett J, Rhodes JM.J Biol Chem. 2004 Oct 1;279(40) :41377-83. Epub 2004 Jul 7.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. The Heidelberg histologic classification of renal cell tumors subdivides renal cell tumors into benign and malignant parenchymal neoplasms and, where possible, limits each subcategory to the most common documented genetic abnormalities (Kovacs et al., 1997). Malignant tumors are subclassified into common or conventional renal cell carcinoma (clear cell); papillary renal cell carcinoma; chromophobe renal cell carcinoma; collecting duct carcinoma, with medullary carcinoma of the kidney; and unclassified renal cell carcinoma. The common or conventional type accounts for about 75% of renal cell neoplasms and is characterized genetically by a highly specific deletion of chromosome 3p. Papillary renal cell carcinoma (see 605074) accounts for about 10% of renal cell tumors. Chromophobe renal cell carcinoma accounts for approximately 5% of renal cell neoplasms. Genetically, chromophobe RCC is characterized by a combination of loss of heterozygosity of chromosomes 1, 2, 6, 10, 13, 17, and 21 and hypodiploid DNA content. Collecting duct carcinoma accounts for about 1% of renal cell carcinoma. Clinical Features. Familial renal cell carcinoma (RCC) is relatively rare. Reports (e.g., Franksson et al., 1972; Goldman et al., 1979) suggest an early average age at diagnosis and frequent bilateral or multiple primary tumors in familial cases. Rusche (1953) observed hypernephroma in 2 brothers. Both had distant metastasis as the first manifestation and both were in their early thirties at the time of diagnosis. Brinton (1960) described a family in which 2 brothers and a sister had hypernephroma. The father had died of kidney tumor and the mother of cancer, site unstated. One of the patients had polycythemia, a known accompaniment of hypernephroma on occasion. It should be noted that hypernephroma and cerebellar hemangioblastoma, which histologically resembles hypernephroma, are features of von Hippel-Lindau disease. Polycythemia also occurs with cerebellar hemangioblastoma.

Jakesz and Wuketich (1978) reported an instructive family in which 3 brothers had bilateral renal cell carcinoma. The index case also had cerebellar hemangioblastoma. The authors suggested that von Hippel-Lindau disease was the fundamental problem. Braun et al. (1975) studied 3 families, each with multiple cases of renal cell carcinoma. There appeared to be an association with HLA W17 tissue type.

Li et al. (1982) reviewed 9 families in which 2 or more members had renal carcinoma. Multiple generations were affected in 5, sibs in 4. The median age at diagnosis was a decade earlier than usual, and individual patients had bilateral or multifocal lesions; these are features of hereditary forms of diverse cancers. No patient had von Hippel-Lindau disease and none had 3;8 translocation.

Levinson et al. (1990) reported that, since 1961, 28 families with multiple cases of renal cell carcinoma had been reported, with an abnormality in the constitutional karyotype having been found in only 1 family. They identified 5 more families in which a total of 12 relatives had renal cell carcinoma; peripheral blood karyotypes from 7 patients and 5 unaffected relatives showed no significant abnormalities. They suggested that members of families with multiple cases of renal cell carcinoma be screened with renal ultrasound initially at age 30, with repeat examinations every 2 or 3 years. The recommendations are similar to those for von Hippel-Lindau disease.

Woodward et al. (2000) reported a clinical and molecular study of familial renal cell carcinoma in 9 kindreds with 2 or more cases of renal cell carcinoma in first-degree relatives. Familial RCC was characterized by an earlier age at onset (mean 47.1 years, 52% of cases less than 50 years of age) as compared to sporadic cases. Mutation analysis of the VHL (608537), MET (164860), and CUL2 (603135) genes revealed no germline mutations. Woodward et al. (2000) concluded that the VHL, MET, and CUL2 genes do not have a major role in familial renal cell carcinoma. Animal Model.Everitt et al. (1992) described the Eker rat, a rodent model of hereditary cancer in which a single gene mutation predisposes them to bilateral multicentric renal cell carcinoma. The disorder bore similarities to von Hippel-Lindau disease. Splenic vascular proliferative lesions, including hemangiosarcoma, were seen in 23% of 14-month-old rats of both sexes that had renal tumors. At that age, 62% of female rats with renal cell tumors had sarcomas of the lower reproductive tract of probable smooth muscle origin. In this rat model of human renal carcinoma, Walker et al. (1992) identified a germline mutation at a tumor susceptibility locus that caused a 70-fold increase in susceptibility to chemical carcinogenesis. A carcinogen that targeted both renal epithelial and mesenchymal cells caused an increase in tumors of epithelial origin in susceptible animals but no increase in carcinogen-induced mesenchymal tumors.

Rats that are heterozygous for the so-called Eker mutation develop spontaneous RCCs between 4 and 12 months of age. When homozygous, the mutation is lethal prenatally at 9 to 10 days of gestation. At the histologic level, renal carcinomas in the Eker rat develop through multiple stages from early preneoplastic lesions (e.g., atypical tubules) to adenomas in virtually all heterozygotes by the age of 1 year. Hino et al. (1993) demonstrated that ionizing radiation induces additional tumors in a linear dose-response relationship, suggesting that in heterozygotes 2 events (one inherited, one somatic) are necessary to produce tumors, and that the predisposing gene is a tumor suppressor gene. No genetic linkage was found between the Eker mutation and rat DNA sequences homologous to those in human chromosome 3p, the presumed site of the putative tumor suppressor gene responsible for human renal cell carcinoma. Nonrandom loss of rat chromosome 5 in RCC-derived cell lines was sometimes associated with homozygous deletion of the interferon gene loci at rat chromosome bands 5q31-q33. Since this locus is not linked to the predisposing inherited gene in the Eker rat, it probably represented a second tumor suppressor gene involved in tumor progression.

Kobayashi et al. (1995) demonstrated that a germline mutation in the tuberous sclerosis-2 gene (191092), caused by the insertion of a DNA fragment approximately 5 kb long, is responsible for aberrant RNA expression from the mutant allele in the Eker rat. Except for the occurrence of renal tumors, the phenotype of tuberous sclerosis in human differs from that of the Eker rat.