Sequence 1 (H1)

Sequence H1
Target	AGFG1 ( Homo sapiens )
Description	"HIV-1 Rev binding protein / ArfGAP with FG repeats 1 Ensembl: ENSG00000173744 UniGene: Hs.591619 , Hs.595484 , Hs.694029 EntrezGene: 5175 Ensembl Chr2: 228045286 - 228130548 Strand: 1 GO terms: 0003677 0003723 0005515 0005634 0005643 0006406 0006810 0007275 0007283 0008270 0030154 0031410 0043087 0046872 "
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) CAGCCCAATGGTGCAGGTTTT / siRNA antisense (21b) AACCTGCACCATTGGGCTGTT
Application	gene silencing
Name	H1

References

hRIP, a cellular cofactor for Rev function, promotes release of HIV RNAs from the perinuclear region.Sánchez-Velar N, Udofia EB, Yu Z, Zapp ML.Genes Dev. 2004 Jan 1;18(1) :23-34. Epub 2003 Dec 30.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Salcini et al. (1997) reported that both the RAB and RABR (604018) proteins bind to the EH protein-protein interaction domain found in EPS15 (600051) and other proteins. Coimmunoprecipitation studies demonstrated that RAB and EPS15 are associated in vivo.

Bogerd et al. (1995) showed that RAB binds to the Rev activation domain in vitro and in vivo and also to functionally equivalent domains in Rex and in other Rev proteins from diverse viruses.

By ablating RIP activity with a dominant-negative mutant or RNA interference, Sanchez-Velar et al. (2004) analyzed the role of RIP in Rev-directed RNA movement by RNA in situ hybridization. In the absence of functional RIP, Rev-directed RNAs mislocalized and aberrantly accumulated at the nuclear periphery, where RIP is localized. In contrast, in the absence of Rev or a Rev cofactor, Rev-directed RNAs remained nuclear. The RNA mislocalization pattern was specific to viral RNA. The intracellular distribution patterns of cellular mRNA, nuclear proteins, and cellular proteins containing a nuclear export signal were unaffected. Sanchez-Velar et al. (2004) concluded that RIP is a cellular Rev cofactor essential for the nuclear export of viral RNAs. Animal Model. Kang-Decker et al. (2001) generated mice deficient in HRB by targeted disruption. Male mice with a null mutation in Hrb were infertile and displayed round-headed spermatozoa that lacked an acrosome. In wildtype spermatids, Hrb was associated with the cytosolic surface of proacrosomic transport vesicles that fuse to create a single large acrosomic vesicle at step 3 of spermiogenesis. Although proacrosomic vesicles form in spermatids that lack Hrb, the vesicles are unable to fuse, blocking acrosome development at step 2. Kang-Decker et al. (2001) concluded that HRB is required for docking and/or fusion of proacrosomic vesicles during acrosome biogenesis.