Sequence 1 (Mipomersen , ISIS 301012 , ISIS-301012 , Kynamro)

Sequence Mipomersen , ISIS 301012 , ISIS-301012 , Kynamro
Target	APOB ( Homo sapiens )
Description	Apolipoprotein B (including Ag(x) antigen) Ensembl: ENSG00000084674 UniGene: Hs.120759 EntrezGene: 603 Ensembl Chr2: 21077806 - 21120450 Strand: -1 GO terms: 0005102 0005319 0005576 0005625 0005783 0005792 0006629 0006642 0006869 0007165 0008015 0008201 0008202 0008203 0030301 0042627
Design	MOE gapmer
Chemistry	moG*moC*moC*moU*moC*A*G*T*C*T*G*C*T*T*C*moG*moC*moA*moC*moC
Sequence	GCCTCAGTCTGCTTCGCACC
Application	Gene silencing
Name	Mipomersen , ISIS 301012 , ISIS-301012 , Kynamro

References

Potent reduction of apolipoprotein B and low-density lipoprotein cholesterol by short-term administration of an antisense inhibitor of apolipoprotein B. Kastelein JJ, Wedel MK, Baker BF, Su J, Bradley JD, Yu RZ, Chuang E, Graham MJ, Crooke RM. Circulation. 2006 Oct 17;114(16):1729-35.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Apolipoprotein B is the main apolipoprotein on chylomicrons and low density lipoproteins (LDLs). It occurs in the plasma in 2 main forms, apoB48 and apoB100. The first is synthesized exclusively by the intestine, the second by the liver. Familial Hypercholesterolemia Type B. Familial hypercholesterolemia can be caused not only by defects in the LDL receptor (LDLR; 606945) but also by mutations in apolipoprotein B causing decreased LDLR binding affinity, so-called familial ligand-defective apolipoprotein B (OMIM 144010). Corsini et al. (1989) described familial hypercholesterolemia (FH) due, not to a defect in the LDLR as in conventional FH (143890), but to binding-defective LDL, presumably familial defective apoB100. Rajput-Williams et al. (1988) demonstrated association of specific alleles for the apoB gene with obesity, high blood cholesterol levels, and increased risk of coronary artery disease. Several of the RFLPs used as markers do not change the amino acid sequence. The authors concluded that these RFLPs are in linkage disequilibrium with nearby functional variation predisposing to obesity or increased risk of coronary artery disease. Variations in serum cholesterol level were associated with 3 functional alleles corresponding to amino acid variants at positions 3611 and 4154, both of which lie near the LDLR binding region of apoB. Products of the APOB gene with high or low affinity for the MB-19 monoclonal antibody can be distinguished. Gavish et al. (1989) used this antibody to identify heterozygotes and detect allele-specific differences in the amount of APOB in the plasma. A family study confirmed that the unequal expression phenotype was inherited in an autosomal dominant manner and was linked to the APOB locus. Noting that large-scale genetic cascade screening for familial hypercholesterolemia showed that 15% of LDLR or APOB mutation carriers had LDLC levels below the 75th percentile, Huijgen et al. (2010) proposed 3 criteria for determining pathogenicity of such mutations: mean LDLC greater than the 75th percentile, higher mean LDLC level in untreated than in treated carriers, and higher percentage of medication users in carriers than in noncarriers at screening. Applying these criteria to 46 mutations found in more than 50 untreated adults, 3 of the mutations were determined to be nonpathogenic: 1 in LDLR and 2 in APOB. Nonpathogenicity of the 3 variants was confirmed by segregation analysis. Huijgen et al. (2010) emphasized that novel sequence changes in LDLR and APOB should be interpreted with caution before being incorporated into a cascade screening program.

Animal Model. Skalen et al. (2002) created transgenic mice expressing 5 types of human recombinant LDL, fed them an atherogenic diet for 20 weeks, and quantitated the extent of atherosclerosis. They used these models to test the hypothesis that the subendothelial retention of atherogenic apoB-containing lipoproteins is the initiating event in atherogenesis. The extracellular matrix of the subendothelium, particularly proteoglycans, is thought to play a major role in the retention of atherogenic lipoproteins. The interaction between atherogenic lipoproteins and proteoglycans involves an ionic interaction between basic amino acids in apoB100 and negatively-charged sulfate groups on the proteoglycans. Skalen et al. (2002) presented direct experimental evidence that the atherogenicity of apoB-containing low-density lipoproteins is linked to their affinity for artery wall proteoglycans. Mice expressing proteoglycan-binding-defective LDL developed significantly less atherosclerosis than mice expressing wildtype control LDL. Skalen et al. (2002) concluded that subendothelial retention of apoB100-containing lipoprotein is an early step in atherogenesis. In order to demonstrate the therapeutic potential of short interfering RNAs (siRNAs), Soutschek et al. (2004) demonstrated that chemically modified siRNAs can silence an endogenous gene encoding apoB after intravenous injection in mice. Administration of chemically modified siRNAs resulted in silencing of the apoB mRNA in liver and jejunum, decreased plasma levels of apoB protein, and reduced total cholesterol. Soutschek et al. (2004) also showed that these siRNAs could silence human apoB in a transgenic mouse model. In their in vivo study, the mechanism of action for the siRNAs was proven to occur through RNA interference (RNAi)-mediated mRNA degradation, and Soutschek et al. (2004) determined that cleavage of the apoB mRNA occurred specifically at the predicted site. Espinosa-Heidmann et al. (2004) studied the development of basal laminar deposits in the eyes of transgenic mice that overexpressed apoB100. The mice were fed a high-fat diet, and their eyes were exposed to blue-green laser light. The results suggested that age and high-fat diet predisposed to the formation of basal laminar deposits by altering hepatic and/or retinal pigment epithelial lipid metabolism in ways more complicated than plasma hyperlipidemia alone. Vitamin E-treated mice showed minimal formation of basal laminar deposits. In the eyes of transgenic mice overexpressing human apoB100 in the RPE, Fujihara et al. (2009) observed ultrastructural changes consistent with early human age-related macular degeneration (ARMD) (see 603075), including loss of basal infoldings and accumulation of cytoplasmic vacuoles in the RPE and basal laminar deposits containing long-spacing collagen and heterogeneous debris in Bruch membrane. In apoB100 mice given a high-fat diet, basal linear-like deposits were identified in 12-month-old mice. Linear regression analysis showed that the genotype was a stronger influencing factor than high-fat diet in producing ARMD-like lesions.