Sequence 298 (Bim-2 , Bim2)

Sequence Bim-2 , Bim2
Target	BCL2L11 ( Homo sapiens )
Description	BCL2-like 11 ( apoptosis facilitator ) Ensembl: ENSG00000153094 UniGene: Hs.469658 EntrezGene: 10018 Ensembl Chr2: 111594962 - 111642493 Strand: 1 GO terms: 0005515 0005624 0006915 0006917 0008017 0016020 0043065
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GCAACCTTCTGATGTAAGTTT / siRNA antisense (21b) ACTTACATCAGAAGGTTGCTT
Application	gene silencing
Name	Bim-2 , Bim2

References

Role of Bim in the survival pathway induced by Raf in epithelial cells.Marani M, Hancock D, Lopes R, Tenev T, Downward J, Lemoine NR.Oncogene. 2004 Apr 1;23(14) :2431-41.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. O'Connor et al. (1998) determined that, like BCL2, BIM contains a hydrophobic C terminus and localizes to intracytoplasmic membranes. Three BIM isoforms, probably generated by alternative splicing, all induce apoptosis, the shortest being the most potent. Wildtype BCL2 associates with BIM in vivo and modulates its death function, whereas BCL2 mutants that lack survival function do neither. Significantly, BCLXL (600039) and BCLW (601931), the 2 closest homologs of BCL2, also bind to BIM and inhibit its activity, but more distant viral homologs, adenovirus E1B19K and Epstein-Barr virus BHRF1, can do neither. Hence, BIM appears to act as a 'death ligand' which can only neutralize certain members of the pro-survival BCL2 subfamily.

Puthalakath et al. (1999) examined the regulation of the proapoptotic activity of BIM. In healthy cells, most BIM molecules were bound to LC8, the cytoplasmic dynein light chain (601562), and thereby sequestered to the microtubule-associated dynein motor complex. Certain apoptotic stimuli disrupted the interaction between LC8 and the dynein motor complex. This freed BIM to translocate together with LC8 to BCL2 and to neutralize its antiapoptotic activity. This process did not require caspase activity, and therefore constitutes an initiating event in apoptosis signaling.

Whitfield et al. (2001) noted that apoptosis induced in rat sympathetic neurons by nerve growth factor (NGF; see 162030) withdrawal can be blocked by inhibitors of RNA and protein synthesis. They presented experimental evidence that activation of the JNK (see 601158)/JUN (165160) pathway and increased expression of BIM are key events required for cytochrome c release and apoptosis following NGF withdrawal.

Dijkers et al. (2002) showed that both cytokine withdrawal and Fkhrl1 (FOXO3A; 602681) activation induced apoptosis in mammalian cell lines through a death receptor-independent pathway. This involved transcriptional upregulation of p27(KIP1) (CDKN1B; 600778) and proapoptotic Bim, loss of mitochondrial integrity, cytochrome c release, and caspase activation. Protein kinase B (AKT1; 164730) protected cells from cytokine withdrawal-induced apoptosis by inhibiting Fkhrl1, resulting in the maintenance of mitochondrial integrity.

BIM is an apoptotic factor that regulates total blood cell number. Matsui et al. (2007) uncovered a molecular mechanism for cytokine-mediated posttranscriptional regulation of Bim mRNA by Hsc70 (HSPA8; 600816) in mouse pro-B cell lines. In the absence of Il3 (147740), Hsc70 formed a complex with Hsp40 (see DNAJB1; 604572) and Hip (ST13; 606796), and this complex, in association with Eif4g (600495) and Pabp (PABPC1; 604679), formed a high-stability complex with Bim mRNA that protected it from ribonucleases. Il3 destabilized Bim mRNA and promoted cell survival by reducing binding of Hsc70 to Bim mRNA by promoting interaction of Hsp70 with Bag4 (603884) and Chip (STUB1; 607207) via the Ras (HRAS; 190020) signaling pathway. Animal Model.Bouillet et al. (1999) disrupted the Bim gene in mice by homologous recombination. The targeting vector replaced the exon encoding BH3, the domain of Bim which is essential for proapoptotic function, with a neo cassette flanked by LoxP sites. As expected, the spleen cells of Bim -/- mice contained no full-length Bim protein. Bim appears to have an important role in embryonic development. Although interbreeding of Bim +/- mice produced healthy and fertile Bim -/- offspring, their number was less than half that of the +/+ progeny. The marked deficit in mutant progeny was not attributable to adventitious mutations introduced during ES cell manipulation, as it appeared in both independent Bim mutant strains and persisted after deletion of the neo cassette. A preliminary analysis indicated that Bim -/- fetuses died before embryonic day 10. However, the penetrance of embryonic lethality appeared to be strongly affected by genetic background. In Bim -/- mice, lymphoid and myeloid cells accumulated, T-cell development was perturbed, and older mice accumulated plasma cells and succumbed to autoimmune kidney disease. Lymphocytes in Bim -/- mice were refractory to apoptotic stimuli such as cytokine deprivation, calcium ion influx, and microtubule perturbation but not to others. Bouillet et al. (1999) concluded that BIM is required for hematopoietic homeostasis and as a barrier to autoimmunity. Moreover, Bouillet et al. (1999) concluded that particular death stimuli appear to activate apoptosis through distinct BH3-only proteins.

Bouillet et al. (2002) showed that thymocytes of Bim-deficient mice are also refractory to apoptosis induced by TCR-CD3 stimulation, whereas immature CD4 (186940)-positive/CD8 (see 186910)-positive (double-positive) thymocytes of normal mice are nearly all killed by this treatment. Likewise, stimulation of thymic organ cultures with superantigen failed to delete TCRv-beta-8+ thymocytes in Bim -/- mice. The complete Bim deficiency in male Bim knockout mice expressing a TCR transgene recognizing the male antigen HY augmented the numbers of autoreactive thymocytes rather than deleting them at the double-positive stage as in wildtype mice. Western blot analysis showed that TCR-CD3 injection of normal mice increases the expression of 2 principal Bim isoforms, Bim(L) and Bim(EL), in complex with Bclxl. Bouillet et al. (2002) concluded that Bim activation is a primary trigger for negative selection of autoreactive T cells during thymic development and that Bim deficiency inhibits both apoptosis induced by TCR-CD3 ligation and the deletion of immature, autoreactive thymocytes more potently than does overexpression of Bcl2.

Oliver et al. (2004) generated mice lacking both Il7 (146660) and Bim. Lack of Bim compensated for lack of Il7 in the survival of B-cell precursors and immature B cells, but it had no impact on the requirement for Il7 in differentiation or proliferation of B-cell precursors. Oliver et al. (2004) concluded that BIM and IL7 cooperate to control the survival of B-cell precursors and that the ability of IL7 to counteract the death-inducing effects of BIM is necessary to maintain the number of B cells that exist in animals.

Pellegrini et al. (2004) generated mice deficient in both Il7r (146661) and Bim. Loss of Bim significantly increased thymocyte numbers, restored near normal numbers of mature T lymphocytes in blood and spleen, and enhanced cytotoxic function against virus infection compared with mice deficient in Il7r only. Pellegrini et al. (2004) concluded that BIM cooperates with other proapoptotic proteins in the death of IL7-deprived progenitor T cells and is the major inducer of the apoptotic pathway in mature T cells. They proposed that pharmacologic inhibition of BIM might be useful in boosting immune responses in immunodeficient patients.

Mailleux et al. (2007) found that Bim was expressed in mammary epithelium from the earliest stage of embryonic development in mice. In Bim -/- mice, mammary epithelial cells were deficient for apoptosis induction in terminal end buds and ducts at 5 weeks of age, and this lack of apoptosis was associated with an absence of lumen formation. However, ducts in Bim -/- mice showed signs of caspase-independent death and squamous differentiation, and by 8 weeks of age the luminal spaces in these ducts were hollowed by an alternative clearance mechanism, resulting in proper lumen formation.