Sequence 353 (Cont)

Sequence Cont
Target	CDKN1A ( Homo sapiens )
Description	Cyclin-dependent kinase inhibitor 1A ( p21, Cip1 ) Ensembl: ENSG00000124762 UniGene: Hs.370771 EntrezGene: 1026 Ensembl Chr6: 36754465 - 36763086 Strand: 1 GO terms: 0000074 0000307 0004672 0004861 0005634 0005737 0005829 0006974 0007049 0007050 0008270 0008285 0008629 0009411 0016301 0030332 0030890 0043066 0043071 0045736 0046872
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) ACTCTATCTGCACGCTGACTT / siRNA antisense (21b) GTCAGCGTGCAGATAGAGTTT
Application	gene silencing
Name	Cont

References

Expression of annexin A3 in primary cultured parenchymal rat hepatocytes and inhibition of DNA synthesis by suppression of annexin A3 expression using RNA interference.Niimi S, Harashima M, Gamou M, Hyuga M, Seki T, Ariga T, Kawanishi T, Hayakawa T.Biol Pharm Bull. 2005 Mar;28(3) :424-8.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. CDKN1A plays a critical role in the cellular response to DNA damage, and its overexpression results in cell cycle arrest. Upregulation of CDKN1A mRNA and protein following ionizing radiation is dependent on p53 (TP53; 191170), and CDKN1A mediates cell cycle arrest in response to the p53 checkpoint pathway (Bendjennat et al., 2003).

Gene Function. By immunoprecipitation analysis, Harper et al. (1993) found that CIP1 associated with cyclin A, cyclin D1, cyclin E, and CDK2 in human diploid fibroblasts. They showed that CIP1 was a potent, tight-binding inhibitor of CDKs that could inhibit phosphorylation of the RB1 protein (614041) by several of these complexes. Cotransfection experiments indicated that CIP1 and SV40T antigen functioned in a mutually antagonistic manner to control cell cycle progression in human fibroblasts.

El-Deiry et al. (1993) found that introduction of WAF1 cDNA suppressed the growth of human brain, lung, and colon tumor cells in culture. Using a yeast enhancer trap, they identified a p53-binding site 2.4 kb upstream of WAF1 coding sequence. The WAF1 promoter, including this p53-binding site, conferred p53-dependent inducibility upon a heterologous reporter gene.

The WAF1-encoded protein p21 mediates p53 suppression of tumor cell growth. Overexpression of p21 in a tumor cell line suppresses colony formation similar to that resulting from p53 overexpression. To localize the tumor suppression function within the structure of p21, Zakut and Givol (1995) used vectors constructed with systematic truncations of p21 and tested their efficiency in suppressing tumor cell growth. They demonstrated that the N-terminal half of the p21 molecule shows better tumor cell growth suppression than the entire p21 molecule, whereas the C-terminal half of p21 did not show this effect.

Apoptosis of human endothelial cells after growth factor deprivation is associated with rapid and dramatic upregulation of cyclin A-associated CDK2 activity. Levkau et al. (1998) showed that in apoptotic cells the C termini of the CDK inhibitors CDKN1A and CDKN1B (600778) are truncated by specific cleavage. The enzyme involved in this cleavage is CASP3 (600636) and/or a CASP3-like caspase. After cleavage, CDKN1A loses its nuclear localization sequence and exits the nucleus. Cleavage of CDKN1A and CDKN1B resulted in a substantial reduction in their association with nuclear cyclin-CDK2 complexes, leading to a dramatic induction of CDK2 activity. Dominant-negative CDK2, as well as a mutant CDKN1A resistant to caspase cleavage, partially suppressed apoptosis. These data suggested that CDK2 activation, through caspase-mediated cleavage of CDK inhibitors, may be instrumental in the execution of apoptosis following caspase activation.

Overexpression of the receptor tyrosine kinase ERBB2 (164870) confers Taxol resistance in breast cancers (114480). Yu et al. (1998) found that overexpression of ERBB2 inhibits Taxol-induced apoptosis. Taxol activates CDC2 kinase (116940) in MDA-MB-435 breast cancer cells, leading to cell cycle arrest at the G2/M phase and, subsequently, apoptosis. A chemical inhibitor of CDC2 and a dominant-negative mutant of CDC2 blocked Taxol-induced apoptosis in these cells. Overexpression of ERBB2 in MDA-MB-435 cells by transfection transcriptionally upregulates CDKN1A which associates with CDC2, inhibits Taxol-mediated CDC2 activation, delays cell entrance to G2/M phase, and thereby inhibits Taxol-induced apoptosis. In CDKN1A antisense-transfected MDA-MB-435 cells or in p21-/- MEF cells, ERBB2 was unable to inhibit Taxol-induced apoptosis. Therefore, CDKN1A participates in the regulation of a G2/M checkpoint that contributes to resistance to Taxol-induced apoptosis in ERBB2-overexpressing breast cancer cells.

Animal Model. To study the role of p21 in ATM (607585)-mediated signal transduction pathways, Wang et al. (1997) examined the combined effects of the genetic loss of ATM and p21 on growth control, radiation sensitivity, and tumorigenesis. p21 modifies the in vitro senescent response seen in AT fibroblasts. Wang et al. (1997) found that p21 is a downstream effector of ATM-mediated growth control. However, loss of p21 in the context of an Atm-deficient mouse leads to delay in thymic lymphomagenesis and an increase in acute radiation sensitivity in vivo (the latter principally because of effects on the gut epithelium). Modification of these 2 crucial aspects of the ATM phenotype can be related to an apparent increase in spontaneous apoptosis seen in tumor cells and in the irradiated intestinal epithelium of mice doubly null for Atm and p21. Thus, loss of p21 seems to contribute to tumor suppression by a mechanism that operates via a sensitized apoptotic response.

Partial renal ablation leads to progressive renal insufficiency in mice and is a model of chronic renal failure from diverse causes. Mice develop functional and morphologic characteristics of chronic renal failure after partial renal ablation, including glomerular sclerosis, systemic hypertension, and reduced glomerular filtration. Megyesi et al. (1999) reported that littermates with a homozygous deletion of the p21 gene did not develop chronic renal failure after ablation. The markedly different reactions of the p21 +/+ and p21 -/- animals were not because of differences in glomerular number or degree of renal growth, but rather because of the presence or absence of the normal p21 gene. Although the reaction to the stress of renal ablation was both hyperplastic and hypertrophic in the presence of a functional p21 gene, it appeared that the absence of the p21 gene may induce a more hyperplastic reaction because proliferating cell nuclear antigen (PCNA; 176740) expression, a marker of cell cycle progression, in the renal epithelium of the remnant kidney was more than 5 times greater in the p21 -/- mice than in the p21 +/+ animals. Because p21 is a potent inhibitor of the cell cycle, Megyesi et al. (1999) speculated that p21 regulates the balance between hyperplasia and hypertrophy after renal ablation. They proposed that this change in response inhibits the development of chronic renal failure. The studies suggested that controlling p21 function may ameliorate or even prevent progressive end-stage renal disease. Al-Awqati and Preisig (1999) commented on the significance of these findings.

Relative quiescence is a defining characteristic of hematopoietic stem cells, while their progeny have dramatic proliferative ability and inexorably move toward terminal differentiation. The quiescence of stem cells has been conjectured to be of critical biologic importance in protecting the stem cell compartment, which Cheng et al. (2000) directly assessed using mice engineered to be deficient in p21. In the absence of p21, hematopoietic stem cell proliferation and absolute number were increased under normal homeostatic conditions. Exposing the animals to cell cycle-specific myelotoxic injury resulted in premature death due to hematopoietic cell depletion. Further, self-renewal of primitive cells was impaired in serially transplanted bone marrow from p21 -/- mice, leading to hematopoietic failure. Cheng et al. (2000) concluded that p21 is the molecular switch governing the entry of stem cells into the cell cycle, and in its absence, increased cell cycling leads to stem cell exhaustion. Under conditions of stress, restricted cell cycling is crucial to prevent premature stem cell depletion and hematopoietic death.

Salvador et al. (2002) showed that GADD45A (126335) is a negative regulator of T-cell proliferation because, compared with wildtype cells, T cells, but not B cells, from Gadd45a-deficient mice had a lower threshold of activation and proliferated to a greater extent. The mutant mice were also prone to a systemic lupus erythematosus (152700)-like condition characterized by high titers of anti-dsDNA, anti-ssDNA, and antihistone antibodies, severe hematologic disorders, autoimmune glomerulonephritis, and premature death. In mice lacking both Gadd45a and p21, the development of autoimmunity was greatly accelerated.

Barboza et al. (2006) noted that the human p53 R175P mutation is deficient in apoptosis but retains partial cell cycle arrest function. They developed a line of mice homozygous for the corresponding mouse mutation (R172P) on a p21-null background and found that loss of p21 completely abolished cell cycle arrest and accelerated tumor onset. Cytogenetic examination of double-mutant sarcomas and lymphomas revealed aneuploidy and chromosomal aberrations that were absent in the single p53-mutant malignancies.