Sequence 443 (CXCR4)

Sequence CXCR4
Target	CXCR4 ( Homo sapiens )
Description	Chemokine ( C-X-C motif ) receptor 4 Ensembl: ENSG00000121966 UniGene: Hs.593413 EntrezGene: 7852 Ensembl Chr2: 136588909 - 136589979 Strand: -1 GO terms: 0000187 0001569 0001584 0001667 0001764 0003779 0004918 0004945 0004947 0004950 0005515 0005737 0005886 0005887 0006915 0006935 0006954 0006955 0007165 0007186 0007204 0007281 0007420
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) CTGGCATTGTGGGCAATGGTT / siRNA antisense (21b) CCATTGCCCACAATGCCAGTT
Application	gene silencing
Name	CXCR4

References

Identification of cell surface targets for HIV-1 therapeutics using genetic screens.Dunn SJ, Khan IH, Chan UA, Scearce RL, Melara CL, Paul AM, Sharma V, Bih FY, Holzmayer TA, Luciw PA, Abo A.Virology. 2004 Apr 10;321(2) :260-73.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Herzog et al. (1993) reported that NPY and a number of other ligands failed to induce any change in cytosolic calcium levels in transfected cells, suggesting that this clone represented a novel neuropeptide receptor. Jazin et al. (1993) independently found that the Y3 receptor does not respond to NPY.

Feng et al. (1996) showed that transient expression of the CXCR4 gene (called 'fusin' by the authors) allowed nonhuman cells coexpressing recombinant CD4 to undergo Env-CD4-mediated cell fusion and productive HIV-1 infection. The authors used Northern analysis to show that fusin mRNA levels correlated with HIV-1 permissiveness in diverse human cell types; Federsppiel et al. (1993) had previously found that D2S201E was expressed in a variety of tissues, including brain and tissues of hemopoietic origin. Feng et al. (1996) also showed that anti-fusin antibodies strongly inhibited HIV-1 infection of normal human CD4+ target cells. The authors commented that the identification of fusin as a fusion cofactor for T-cell line-tropic HIV-1 isolates provided a new means of elucidating the mechanism of HIV-1 infection and suggested that production of an effective small-animal model of HIV infection might be possible.

Bleul et al. (1996) and Oberlin et al. (1996) reported that stromal cell-derived factor-1 (SDF1; 600835), also known as CXCL12 and PBSF, is a ligand for this receptor, which they referred to as CXCR4. Both groups found that SDF1 is a potent inhibitor in vitro of infection by lymphocyte-tropic HIV-1 strains. Oberlin et al. (1996) showed that the CC chemokines MIP-1-alpha (182283), MIP-1-beta (182284), and RANTES (187011), which inhibit monocyte-tropic HIV-1 infection via the CC chemokine receptor CMKBR5 (CCR5; 601373), were inactive against lymphocyte-tropic HIV-1 strains. Conversely, Bleul et al. (1996) showed that SDF1 does not inhibit CMKBR5-mediated infection by macrophage-tropic and dual-tropic HIV-1.

CCR5 is the major macrophage-tropic coreceptor for HIV-1, whereas CXCR4 serves the counterpart function for T cell-tropic viruses. Xiao et al. (2000) provided an explanation for the mystery of why only R5-HIV-1 is initially detected in new seroconvertors who are exposed to R5 and X4 viruses. Indeed, X4 virus emerges in a minority of patients and only in the late stages of disease, suggesting that early negative selection against HIV-1-CXCR4 interaction may exist. Xiao et al. (2000) reported that the HIV-1 Tat protein (HTATIP; 601409), which is secreted from virus-infected cells, is a CXCR4-specific antagonist. Soluble Tat selectively inhibited the entry and replication of X4, but not R5, virus in peripheral blood mononuclear cells. The authors proposed that one functional consequence of secreted Tat is to select against X4 viruses, thereby influencing the early in vivo course of HIV-1 disease.

Peled et al. (1999) demonstrated that SDF1 and its receptor CXCR4 are critical for murine bone marrow engraftment by human SCID repopulating stem cells. Treatment of human cells with anti-CXCR antibodies prevented engraftment. They further demonstrated that CD34(+)CD38(-/low) cells could be converted to CD34(+)CD38(-/low)CXCR4(+) stem cells by pretreatment with IL6 (147620) and stem cell factor (KITLG; 184745), which increased CXCR4 expression. This pretreatment potentiated migration to SDF1 and engraftment in primary and secondary transplanted mice. Animal Model.Vascularization of organs generally occurs by remodeling of the preexisting vascular system during their differentiation and growth to enable them to perform their specific functions during development. The molecules required for early vascular systems, many of which are receptor tyrosine kinases and their ligands, are revealed by analysis of mutant mice. As most of these mice die during early gestation before many of their organs have developed, the molecules responsible for vascularization during organogenesis are not identified by this approach. CXCR4 is responsible for B-cell lymphopoiesis, bone marrow myelopoiesis, and cardiac ventricular septum formation. CXCR4 also functions as a coreceptor for HIV-1 and is a receptor for the CXC chemokine PBSF/SDF1 (600835). Tachibana et al. (1998) showed that CXCR4 is expressed in developing vascular endothelial cells. Tachibana et al. (1998) found that mice lacking either CXCR4 or PBSF/SDF1 have defective formation of the large vessels supplying the gastrointestinal tract. In addition, mice lacking CXCR4 die in utero and are defective in vascular development, hematopoiesis and cardiogenesis, like mice lacking PBSF/SDF1, indicating that CXCR4 is a primary physiologic receptor for PBSF/SDF1. Tachibana et al. (1998) concluded that PBSF/SDF1 and CXCR4 define a new signaling system for organ vascularization.

Zou et al. (1998) pointed out that CXCR4 is broadly expressed in cells of both the immune and the central nervous systems and can mediate migration of resting leukocytes and hematopoietic progenitors in response to its ligand, SDF1. They showed that mice lacking CXCR4 exhibit hematopoietic and cardiac defects identical to those of SDF1-deficient mice (Nagasawa et al., 1996), indicating that CXCR4 may be the only receptor for SDF1. Furthermore, fetal cerebellar development in mutant animals was markedly different from that in wildtype animals, with many proliferating granule cells invading the cerebellar anlage. This appeared to be the first demonstration of the involvement of a G protein-coupled chemokine receptor in neuronal cell migration and patterning in the central nervous system. They suggested that the results are important for designing strategies to block HIV entry into cells and for understanding mechanisms of pathogenesis in AIDS dementia.

Ma et al. (1998) found that mice deficient for Cxcr4 or its ligand Sdf1 died perinatally with defects in both the hemopoietic and nervous systems, whereas heterozygotes were normal. Reduced B-lymphopoiesis and myelopoiesis were observed in fetal liver, and myelopoiesis was absent in bone marrow; however, T-lymphopoiesis was normal. In the nervous system, the cerebellum developed with an irregular external granule cell layer, ectopically located Purkinje cells, and numerous chromophilic cell clumps of granule cells that had migrated abnormally within the cerebellar anlage.

CXCR4 mRNA is expressed at sites of neuronal and progenitor cell migration in the hippocampus at late embryonic and early postnatal ages. SDF1 mRNA, the only known ligand for the CXCR4 receptor, is expressed close to these migration sites, in the meninges investing the hippocampal primordium and in the primordium itself. In mice engineered to lack the CXCR4 receptor, Lu et al. (2002) found that the morphology of the hippocampal dentate gyrus was dramatically altered. Gene expression markers for dentate gyrus granule neurons and bromodeoxyuridine labeling of dividing cells showed an underlying defect in the stream of postmitotic cells and secondary dentate progenitor cells that migrate toward and form the dentate gyrus. In the absence of CXCR4, the number of dividing cells in the migratory stream and in the dentate gyrus itself was reduced, and neurons appeared to differentiate prematurely before reaching their target. Thus, Lu et al. (2002) concluded that the SDF1/CXCR4 chemokine signaling system has a role in dentate gyrus morphogenesis. The dentate gyrus is unusual as a site of adult neurogenesis. They found that both CXCR4 and SDF1 are expressed in the adult dentate gyrus, suggesting an ongoing role in dentate gyrus morphogenesis.

Knaut et al. (2003) applied genetics and in vivo imaging to show that 'odysseus,' a zebrafish homolog of the G protein-coupled chemokine receptor Cxcr4, is required specifically in germ cells for their chemotaxis. Odysseus mutant germ cells are able to activate the migratory program, but fail to undergo directed migration toward their target tissue, resulting in randomly dispersed germ cells. SDF1, the presumptive cognate ligand for Cxcr4, showed a similar loss of function phenotype and can recruit germ cells to ectopic sites in the embryo, thus identifying a vertebrate ligand-receptor pair guiding migratory germ cells at all stages of migration toward their target.