Sequence 461 (ISIS-445569 , ISIS 445569)

Sequence ISIS-445569 , ISIS 445569
Target	DMPK ( Homo sapiens )
Description	Dystrophia myotonica-protein kinase Ensembl: ENSG00000104936 UniGene: Hs.631596 EntrezGene: 1760 Ensembl Chr19: 50964818 - 50977655 Strand: -1 GO terms: 0000166 0000287 0004672 0004674 0004713 0005524 0006464 0006468 0008016 0016740 0042802 0051056
Design	MOE gapmer
Chemistry	moC*moG*moG*moA*moG*C*G*G*T*T*G*T*G*A*A*moC*moT*moG*moG*moC
Sequence	CGGAGCGGTTGTGAACTGGC
Application	gene silencing
Name	ISIS-445569 , ISIS 445569

References

Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Wheeler TM1, Leger AJ, Pandey SK, MacLeod AR, Nakamori M, Cheng SH, Wentworth BM, Bennett CF, Thornton CA. Nature. 2012 Aug 2;488(7409):111-5.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Myotonic dystrophy is an autosomal dominant disorder characterized mainly by myotonia, muscular dystrophy, cataracts, hypogonadism, frontal balding, and ECG changes. The genetic defect in DM1 results from an amplified trinucleotide repeat in the 3-prime untranslated region of a protein kinase gene. Disease severity varies with the number of repeats: normal individuals have 5 to 37 repeats, mildly affected persons have 50 to 150 repeats, patients with classic DM have 100 to 1,000 repeats, and those with congenital onset can have more than 2,000 repeats. The disorder shows genetic anticipation, with expansion of the repeat number dependent on the sex of the transmitting parent. Alleles of 40 to 80 repeats are usually expanded when transmitted by males, whereas only alleles longer than 80 repeats tend to expand in maternal transmissions. Repeat contraction events occur 4.2 to 6.4% of the time (Musova et al., 2009).

Gene Function. Using antisera developed against synthetic DMPK peptide antigens for biochemical and histochemical studies, van der Ven et al. (1993) found lower levels of immunoreactive DM kinase protein of 53 kD in skeletal and cardiac muscle extracts of myotonic dystrophy (DM1; 160900) patients than in normal controls. Immunohistochemical staining revealed that DMPK is localized predominantly at sites of neuromuscular and myotendinous junctions of human and rodent skeletal muscles. The protein could also be demonstrated in the neuromuscular junctions of muscular tissues of adult and congenital cases of DM, with no gross changes in structural organization. Using several synthetic peptide substrates, Wansink et al. (2003) characterized the substrate requirements of mouse Dmpk. Dmpk phosphorylated threonine residues more efficiently than serine, and activity increased with positively charged amino acids, preferably arginine, at positions -1 to -3. A VSGGG motif in the kinase C-terminal domain modulated both Dmpk autophosphorylation activity and protein conformation, and alternatively spliced elements in the C terminus regulated substrate specificity and intracellular localization. Proteins with a hydrophobic C terminus targeted to the endoplasmic reticulum, while those with a more hydrophilic C terminus bound to the mitochondrial outer membrane, and those with a short C-terminal tail adopted a cytosolic location. The CTG repeats associated with DM1 are a component of a CTCF (604167)-dependent insulator element, and repeat expansion results in conversion of the region to heterochromatin. Cho et al. (2005) showed that the wildtype DM1 insulator is associated with bidirectional transcription, antisense transcripts that emanate from the adjacent SIX5 regulatory region and are converted into 21-nucleotide RNA fragments, H3-K9 dimethylation and H3-K4 trimethylation, and HP1-gamma (CBX3; 604477) recruitment in the region of the CTG repeats. They found that expansion of the CTG repeat in DM1 is associated with reduced or absent CTCF binding, spread of heterochromatin, and regional CpG methylation.

Animal Model. Gourdon et al. (1997) and Monckton et al. (1997) independently studied the behavior of the myotonic dystrophy CTG repeat in transgenic mice. Monckton et al. (1997) generated transgenic mouse lines that transmit a fragment of the human DM kinase gene, a 3-prime UTR-containing construct initially containing 162 CTG repeats. Gourdon et al. (1997) used a much larger genomic fragment (about 45 kb) as a transgene, originally derived from the DNA for a DM patient with 55 CTG repeats in the mutant allele. This cosmid clone not only housed the entire DM gene, but also contained sequences corresponding to the 2 genes immediately flanking the DM kinase gene. Both studies clearly documented intergenerational and somatic cell instability of the trinucleotide repeat in the transgenic mice. Lia et al. (1998) studied somatic instability by measuring the CTG repeat length at several ages in various tissues of transgenic mice carrying a (CTG)55 expansion surrounded by 45 kb of the human DM region. These mice had been shown to reproduce the intergenerational and somatic instability of the 55 CTG repeat, suggesting that surrounding sequences and the chromatin environment are involved in instability mechanisms. As observed in some of the tissues of DM patients, there was a tendency for repeat length and somatic mosaicism to increase with the age of the mouse. Furthermore, Lia et al. (1998) observed no correlation between the somatic mutation rate and tissue proliferation capacity. Somatic mutation rates in different tissues were also not correlated to the relative intertissue differences in transcriptional levels of the 3 genes that surround the repeat: DMAHP (600963), DMPK, and 59. Similar studies by Seznec et al. (2000) with transgenic mice carrying greater than 300 CTG repeats demonstrated a strong bias towards expansions (vs contractions), similar sex- and size-dependent expansion characteristics as in humans, and a high level of instability (increasing with age) in tissues and in sperm.

Klesert et al. (2000) and Sarkar et al. (2000) independently developed mice with targeted disruption of the Six5 gene. Both animal models developed cataracts, leading Klesert et al. (2000) and Sarkar et al. (2000) to conclude that myotonic dystrophy represents a contiguous gene syndrome involving deficiency of both SIX5 and DMPK.

The CTG expansion causing DM results in transcriptional silencing of the flanking SIX5 allele. Sarkar et al. (2004) generated Six5 knockout and heterozygous mice by targeted disruption and demonstrated a strict requirement of Six5 for both spermatogenic cell survival and spermiogenesis. Leydig cell hyperproliferation and increased intratesticular testosterone levels were observed in the Six5 -/- mice. Although increased FSH (see 136530) levels were observed in the Six5 +/- and Six5 -/- mice, serum testosterone levels and intratesticular inhibin alpha (INHA; 147380) and inhibin beta-B (INHBB; 147390) levels were not altered in the Six5 mutant animals when compared with controls. Steady-state c-Kit (164920) levels were reduced in the Six5 -/- testis. The authors concluded that decreased c-Kit levels could contribute to the elevated spermatogenic cell apoptosis and Leydig cell hyperproliferation in the Six5 -/- mice. They hypothesized that the reduced SIX5 levels may contribute to the male reproductive defects in DM1.

Dmpk knockout mice show only mild muscle weakness and abnormal cardiac conduction; Six5 knockout mice develop cataracts only; neither mouse model develops myotonia. Mankodi et al. (2000) investigated the possibility that the pathogenic effect of the DM mutation is mediated by the mutant mRNA, i.e., that the nuclear accumulation of expanded CUG repeats is toxic to muscle fibers. They developed transgenic mice that express human skeletal actin (ACTA1; 102610) with either a nonexpanded (5-CTG) or an expanded (approximately 250-CTG) repeat in the final exon of the ACTA1 gene, midway between the termination codon and the polyadenylation site. Mice that expressed the expanded repeat developed myotonia and myopathy, whereas mice expressing the nonexpanded repeat did not. Thus, transcripts with expanded CUG repeats are sufficient to generate a DM phenotype. Mankodi et al. (2000) concluded that these results support a role for RNA gain of function in disease pathogenesis.

Mounsey et al. (2000) measured macroscopic and single channel sodium currents from cell-attached patches of skeletal myocytes from heterozygous (DMPK +/-) and homozygous (DMPK -/-) mice. In DMPK -/- myocytes, sodium current amplitude was reduced because of reduced channel number. Single channel recordings revealed sodium channel reopenings, similar to the gating abnormality of human myotonic muscular dystrophy, which resulted in a plateau of sodium current. The gating abnormality deteriorated with increasing age. In DMPK +/- muscle there was reduced sodium current amplitude and increased sodium channel reopenings identical to those in DMPK -/- muscle. The authors hypothesized that DMPK deficiency underlies the sodium channel abnormality in DM.

In tissues cultured from Dmt mice, Gomes-Pereira et al. (2001) noted the progressive accumulation of larger alleles as a result of repeat length changes in vitro, as confirmed by single cell cloning. The authors also observed the selection of cells carrying longer repeats during the first few passages of the cultures and frequent additional selective sweeps at later stages. The highest levels of instability were observed in cultured kidney cells, whereas the transgene remained relatively stable in eye cells and very stable in lung cells, paralleling the previous in vivo observations. No correlation between repeat instability and the cell proliferation rate was found, rejecting a simple association between length change mutations and cell division, and suggesting a role for additional cell-type specific factors.

Kanadia et al. (2003) found that mice with targeted deletion of exon 3 of the Mbnl1 gene (606516) developed overt myotonia with myotonic discharges on EMG at approximately 6 weeks of age. In addition to muscle abnormalities, the mice also developed ocular cataracts similar to DM1. These mice showed decreased expression and abnormal splicing of Clcn1, Tnnt2, and Tnnt3 (600692). Kanadia et al. (2003) concluded that Mbnl1 plays a direct role in splice site selection of different proteins and that manifestations of DM1 can result from sequestration of specific RNA-binding proteins.

In Mbnl1-deficient Drosophila embryos, Machuca-Tzili et al. (2006) found abnormal splicing of the Z-band associated proteins CG30084, which is the Drosophila homolog of ZASP/LDB3 (605906), and alpha-actinin. Studies of skeletal muscle tissue from 3 unrelated DM1 patients showed abnormal splicing of LDB3 but normal splicing of alpha-actinin-2 (ACTN2; 102573). The findings suggested that the molecular breakdown of Z-band structures in flies and DM1 patients may involve the MBNL1 gene.

Wang et al. (2007) generated an inducible and heart-specific mouse model of DM1 that expressed expanded human DMPK CUG-repeat RNA and recapitulated pathologic features of the human disorder, including dilated cardiomyopathy, arrhythmias, and systolic and diastolic dysfunction. The mice also showed misregulation of developmental alternative splicing transitions, including the Tnnt2 and Fxr1 (600819) genes. All died of heart failure within 2 weeks. Immunohistochemical studies showed increased CUGBP1 protein levels specifically in nuclei containing foci of DMPK CUG-repeat RNA. A time-course study showed that increased CUGBP1 cooccurred within hours of induced expression of the CUG repeat and coincided with reversion to embryonic splicing patterns. The results indicated that increased CUGBP1 is a specific and early event of DM1 pathogenesis and represents a primary response to expression of DMPK CUG-repeat mutant RNA. Wheeler et al. (2007) reported that an antisense oligonucleotide targeting the 3-prime splice site of exon 7a of the Clc1 gene (CLCN1; 118425) reversed the defect of Clc1 alternative splicing in 2 mouse models of DM. By repressing the inclusion of this exon, the treatment restored the full-length reading frame of Clc1 mRNA, upregulated Clc1 expression, normalized Clc1 current density, and eliminated myotonic discharges. The findings supported the hypothesis that myotonia and chloride channelopathy observed in DM results from abnormal alternative splicing of CLC1.

Osborne et al. (2009) performed global mRNA profiling in transgenic mice that expressed CUG(exp) RNA, when compared with Mbnl1-knockout mice. The majority of changes induced by CUG(exp) RNA in skeletal muscle could be explained by reduced activity of Mbnl1, including many changes that are secondary to myotonia. The pathway most affected comprised genes involved in calcium signaling and homeostasis. Some effects of CUG(exp) RNA on gene expression were caused by abnormal alternative splicing or downregulation of Mbnl1-interacting mRNAs. However, several of the most highly dysregulated genes showed altered transcription, as indicated by parallel changes of the corresponding pre-mRNAs. Osborne et al. (2009) proposed that transdominant effects of CUG(exp) RNA on gene expression in this transgenic mouse model may occur at the level of transcription, RNA processing, and mRNA decay, and may be mediated mainly, but not entirely, through sequestration of Mbnl1.

Koshelev et al. (2010) expressed human CUGBP1 in adult mouse heart. Upregulation of CUGBP1 was sufficient to reproduce molecular, histopathologic, and functional changes observed in a DM1 mouse model that expressed expanded CUG RNA repeats (Wang et al., 2007) as well as in individuals with DM1. The authors concluded that CUGBP1 upregulation plays an important role in DM1 pathogenesis. By inducing expression of human CUGBP1 in adult skeletal muscle of transgenic mice, Ward et al. (2010) showed that the pathogenic features of DM1 could be explained by upregulated CUGBP1 expression. Within weeks of induction of CUGBP1 expression, transgenic mice exhibited impaired movement, reduced muscle function, abnormal gait, and reduced total body weight compared with uninduced controls. Histologic analysis of transgenic muscle overexpressing CUGBP1 revealed centrally located nuclei, myofiber degeneration with inflammatory infiltrate, and pyknotic nuclear clumps. RT-PCR analysis revealed reversion to embryonic splicing patterns in several genes in transgenic muscle overexpressing CUGBP1. Ward et al. (2010) concluded that CUGBP1 has a major role in DM1 skeletal muscle pathogenesis.

Wheeler et al. (2012) showed that nuclear-retained transcripts containing expanded CUG repeats are unusually sensitive to antisense silencing. In a transgenic mouse model of DM1, systemic administration of antisense oligonucleotides caused a rapid knockdown of CUG expansion RNA in skeletal muscle, correcting the physiologic, histopathologic, and transcriptomic features of the disease. The effect was sustained for up to 1 year after treatment was discontinued. Systemically administered ASOs were also effective for muscle knockdown of Malat1 (607924), a long noncoding RNA that is retained in the nucleus. Wheeler et al. (2012) concluded that their results provided a general strategy to correct RNA gain-of-function effects and to modulate the expression of expanded repeats, long noncoding RNAs, and other transcripts with prolonged nuclear residence.