Sequence 469 ()

Sequence
Target	DNMT1 ( Homo sapiens )
Description	DNA ( cytosine-5- )-methyltransferase 1 Ensembl: ENSG00000129757 UniGene: Hs.202672 EntrezGene: 1786 Ensembl Chr11: 2861019 - 2863555 Strand: -1 GO terms: 0000079 0000080 0000122 0004861 0005515 0005634 0007049 0007050 0008285 0042551 0045735
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) CGAGTTGCTAGACCGCTTCTT / siRNA antisense (21b) GAAGCGGTCTAGCAACTCGTT
Application	gene silencing
Name

References

RNA interference-mediated knockdown of DNA methyltransferase 1 leads to promoter demethylation and gene re-expression in human lung and breast cancer cells.Suzuki M, Sunaga N, Shames DS, Toyooka S, Gazdar AF, Minna JD.Cancer Res. 2004 May 1;64(9) :3137-43.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Beckwith-Wiedemann syndrome is a pediatric overgrowth disorder involving a predisposition to tumor development. The clinical presentation is highly variable; some cases lack the hallmark features of exomphalos, macroglossia, and gigantism as originally described by Beckwith (1969) and Wiedemann (1969) (summary by Weksberg et al., 2010).

Clinical Features. Individuals with BWS may grow at an increased rate during the latter half of pregnancy and in the first few years of life, but adult heights are generally in the normal range. Abnormal growth may also manifest as hemihypertrophy and/or macroglossia. Hypoglycemia is reported in 30 to 50% of babies with BWS. There is an increased frequency of malformations and medical complications, including abdominal wall defects (omphalocele, umbilical hernia, and diastasis recti) and visceromegaly involving liver, spleen, pancreas, kidneys, or adrenals. Fetal adrenocortical cytomegaly is a pathognomonic finding. Renal anomalies may include primary malformations, renal medullary dysplasia, nephrocalcinosis, and nephrolithiasis. There is a predisposition to embryonal malignancies, with Wilms tumor and hepatoblastoma the most common (review by Weksberg et al., 2010).

Irving (1967, 1970) initially described the 'typical linear indentations of the lobe' that have become one of the diagnostic criteria, also well documented by Best and Hoekstra (1981). Peculiar posterior helical ear pits were first described in the BWS by Kosseff et al. (1972) and later by many others (see Best, 1991).

Two reported patients had hearing loss due to fixation of the stapes (Paulsen, 1973 and Daugbjerg and Everberg, 1984). In 3 patients, BWS and type III polycystic kidney disease occurred simultaneously (Mulvihill et al., 1989). An adult woman developed a progressive virilization due to her androgen-secreting adrenal carcinoma (Clouston et al., 1989).

A review of 31 patients with BWS and malignant tumors showed that 18 had Wilms tumor (Sotelo-Avila et al., 1980). Wiedemann (1983) reported that of 388 children, 29 developed 32 neoplasms. Of these tumors, 26 were intraabdominal, 14 being Wilms tumors and 5 adrenocortical carcinoma. Hemihypertrophy, partial or complete, was noted in 12.5% of the cases but in more than 49% of the children with neoplasms.

Wiedemann (1989) commented on overgrowth of the external genitalia in both males and females with BWS. Sippell et al. (1989) reported longitudinal data on height, bone maturation, weight, and pubertal development in 7 children with BWS. The children reached an average height of 2.5 SD above the mean at or after puberty. Growth velocity was above the ninetieth percentile until 4 to 6 years of age, and normal thereafter. Bone age was significantly advanced in all patients studied. One of the patients had latent hypothyroidism. The association of BWS and thyroid disorders may be more than coincidental (Leung, 1985 and Leung and McArthur, 1989). Emery et al. (1983) reported 2 affected sibs, one with thoracic neuroblastoma and the other who died at age 2 months of cardiomyopathy and respiratory failure. Animal Model.Zhang et al. (1997) produced targeted disruption of the p57(KIP2) gene (CDKN1C; 600856) in mice and demonstrated that they have altered cell proliferation and differentiation, leading to abdominal muscle defects; cleft palate; endochondral bone ossification defects with incomplete differentiation of hypertrophic chondrocytes; renal medullary dysplasia; adrenal cortical hyperplasia and cytomegaly; and lens cell hyperproliferation and apoptosis. Since many of these phenotypes are observed in patients with BWS, Zhang et al. (1997) suggested that the observations support a loss of p57(KIP2) expression as having a role in that disorder. Omphalocele was a feature of the mutant mice; mutant embryos showed umbilical abnormalities as early as E16.5. Neonatal lethality was due to defects in the closure of the secondary palate, with aspiration of milk and swallowing of air causing inflation and stretching of the stomach and intestines. Renal medullary dysplasia caused enlargement of the kidneys. Zhang et al. (1997) noted that type X collagen (120110) is expressed in hypertrophic chondrocytes and has been implicated in proper bone development. In mutant mice, expression of type X collagen was significantly reduced in the mutant hypertrophic zone. Thus, the investigators concluded that p57(KIP2) is required for expression of collagen X, and perhaps for other genes that facilitate the ossification of chondrocytes. Expression of p57(KIP2) is restricted to the fetal adrenal cortex and presumably plays a role in controlling cell proliferation; its absence leads to adrenal cortex hyperplasia and cytomegaly. The adrenal gland is among the most consistently enlarged organs in BWS patients. Some other manifestations of BWS are not so easily explained by the loss of control by this cyclin-dependent kinase inhibitory protein, e.g., the defects in kidney development and formation of the secondary palate.

In human and mouse, most imprinted genes are arranged in chromosomal clusters. Their linked organization suggests coordinated mechanisms controlling imprinting and gene expression. Identification of local and regional elements responsible for the epigenetic control of imprinted gene expression is important for understanding the molecular basis of disorders associated with imprinting such as BWS. Paulsen et al. (1998) established a complete contig of clones along the murine imprinting cluster on distal chromosome 7 syntenic with the human imprinting region at chromosome 11p15.5 (BWCR) associated with BWS. The cluster comprises approximately 1 Mb of DNA, contains at least 8 imprinted genes, and is demarcated by the 2 maternally expressed genes Ipl (602131) and H19 (103280), which are directly flanked by the nonimprinted genes Nap1l4 (601651) and L23mrp (600789), respectively. Paulsen et al. (1998) also localized Kvlqt1 (KCNQ1; 607542) and Tapa1 (186845) between Cdkn1c (600856) and Mash2 (601886). The mouse Kvlqt1 gene was maternally expressed in most fetal tissues but biallelically transcribed in most neonatal tissues, suggesting relaxation of imprinting during development.

In connection with reports that in vitro fertilization may increase the risk of BWS, it is noteworthy that in sheep and cattle, epigenetic abnormalities have been shown to be involved in large offspring syndrome (LOS) (Young et al., 1998). Affected animals exhibit various phenotypes, including large size at birth. In both species, the syndrome is caused by the in vitro exposure of embryos, between fertilization and the blastocyst stage, to various unusual environments. LOS is related to the loss of imprinting of the IGF2 receptor gene (147280), which ensures internalization and degradation of IGF2 (147270) and displays an antiproliferative function (Young et al., 2001).

The proximal imprinting center IC1 is located about 2-kb upstream of the H19 gene, and the distal imprinting center IC2 is located within intron 10 of the Kcnq1 gene. Lefebvre et al. (2009) engineered an interstitial deletion of the approximately 280-kb intervening region between the 2 imprinting centers IC1 and IC2 on mouse chromosome 7. The deletion was flanked by the Ins2 and Ascl2 (601886) genes. The deletion allele, Del(7AI), was silent with respect to epigenetic marking at the 2 flanking imprinting centers. Reciprocal inheritance of Del(7AI) demonstrated that the deleted region, which represents more than a quarter of the previously defined imprinted domain, is associated with intrauterine growth restriction in maternal heterozygotes. In homozygotes, the deficiency behaved as a tyrosine hydroxylase (TH; 191290)-null allele and could be rescued pharmacologically by bypassing the metabolic requirement for tyrosine hydroxylase in utero. Lefebvre et al. (2009) concluded that the deleted interval is not required for normal imprinting on distal mouse chromosome 7.