Sequence 645 (Fomivirsen , Vitravene , ISIS 2922 , ISIS-2922)
From Wikisequences
| Sequence Fomivirsen , Vitravene , ISIS 2922 , ISIS-2922 | |
|---|---|
| Target | human CMV immediate-early 2 ( IE2 ) |
| Description | Human CMV immediate-early 2 |
| Design | phosphorothioate oligonucleotide |
| Chemistry | G*C*G*T*T*T*G*C*T*C*T*T*C*T*T*C*T*T*G*C*G |
| Sequence | GCGTTTGCTCTTCTTCTTGCG |
| Application | gene silencing |
| Name | Fomivirsen , Vitravene , ISIS 2922 , ISIS-2922 |
References
Antiviral activity of a phosphorothioate oligonucleotide complementary to RNA of the human cytomegalovirus major immediate-early region. Azad RF, Driver VB, Tanaka K, Crooke RM, Anderson KP. Antimicrob Agents Chemother. 1993 Sep;37(9):1945-54.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
