Sequence 894 (MYO6-1)

From Wikisequences
Jump to: navigation, search
Sequence MYO6-1
Target MYO6 ( Homo sapiens )
Description Myosin VI

Ensembl: ENSG00000165417

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) GCTGGCAGTTCATAGGAATTT / siRNA antisense (21b) ATTCCTATGAACTGCCAGCTT
Application gene silencing
Name MYO6-1

References

Lessons from border cell migration in the Drosophila ovary: A role for myosin VI in dissemination of human ovarian cancer.Yoshida H, Cheng W, Hung J, Montell D, Geisbrecht E, Rosen D, Liu J, Naora H.Proc Natl Acad Sci U S A. 2004 May 25;101(21) :8144-9. Epub 2004 May 14.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Description. Accurate transcription initiation on TATA-containing class II genes involves the ordered assembly of RNA polymerase II (POLR2A; 180660) and several general initiation factors. One of these factors is TFIIA, which when purified from HeLa extracts consists of 35-, 19-, and 12-kD subunits (summary by DeJong and Roeder, 1993). Gene Function. High levels of gene transcription by RNA polymerase II depend on high rates of transcription initiation and reinitiation. Initiation requires recruitment of the complete transcription machinery to a promoter, a process facilitated by activators and chromatin remodeling factors. Reinitiation is thought to occur through a different pathway. After initiation, a subset of the transcription machinery remains at the promoter, forming a platform for assembly of a second transcription complex. Yudkovsky et al. (2000) described the isolation of a reinitiation intermediate in yeast that includes transcription factors TFIID (see 313650), TFIIA, TFIIH (see 189972), TFIIE (see 189962), and Mediator (see 602984). This intermediate can act as a scaffold for formation of a functional reinitiation complex. Formation of this scaffold is dependent on ATP and TFIIH. In yeast, the scaffold is stabilized in the presence of the activator Gal4-VP16, but not Gal4-AH, suggesting a new role for some activators and Mediator in promoting high levels of transcription.

Support Doctors Without Borders