Sequence 914 (SRC2)

Sequence SRC2
Target	NCOA2 ( Homo sapiens )
Description	Nuclear receptor coactivator 2 Ensembl: ENSG00000140396
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GTCAGATGTATCCTCTACATT / siRNA antisense (21b) TGTAGAGGATACATCTGACTT
Application	gene silencing
Name	SRC2

References

Progesterone and glucocorticoid receptors recruit distinct coactivator complexes and promote distinct patterns of local chromatin modification.Li X, Wong J, Tsai SY, Tsai MJ, O'Malley BW.Mol Cell Biol. 2003 Jun;23(11) :3763-73.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. The NCOA2 gene encodes nuclear receptor coactivator 2, which aids in the function of nuclear hormone receptors. Nuclear hormone receptors are conditional transcription factors that play important roles in various aspects of cell growth, development, and homeostasis by controlling expression of specific genes. Members of the nuclear hormone receptor superfamily, which includes the 5 steroid receptors and class II nuclear receptors (see below), are structurally characterized by 3 distinct domains: an N-terminal transcriptional activation domain, a central DNA-binding domain, and a C-terminal hormone-binding domain. Before the binding of hormone, steroid receptors, which are sometimes called class I of the nuclear hormone receptor family, remain inactive in a complex with heat-shock protein-90 (140571) and other stress family proteins. Binding of hormone induces critical conformational changes in steroid receptors that cause them to dissociate from the inhibitory complex, bind as homodimers to specific DNA enhancer elements associated with target genes, and modulate that gene's transcription. After binding to enhancer elements, transcription factors require transcriptional coactivator proteins to mediate their stimulation of transcription initiation (Hong et al., 1997). Gene Function. Hong et al. (1997) found that full-length GRIP1 interacts with the hormone binding domains of all 5 steroid receptors in a hormone-dependent manner and also with hormone binding domains of class II nuclear receptors, including thyroid receptor-alpha (190120), vitamin D receptor (601769), retinoic acid receptor-alpha (180240), and retinoid X receptor-alpha (180245).

Myogenesis involves 2 processes, determination and differentiation. Embryonic precursor cells become committed to the muscle lineage during determination. In differentiation, the committed cells, or myoblasts, acquire the contractile phenotype and form postmitotic multinucleated cells. Proliferating myoblasts in culture express myogenic differentiation antigen-1 (MYOD; 159970) and myogenic factor-5 (MYF5; 159990), whereas expression of myogenin (MYOG; 159980) coincides with terminal differentiation. In addition to MYOG, a basic helix-loop-helix (bHLH) protein, differentiation involves the concerted activation of members of the MEF2 family (see MEF2A; 600660). CREB-binding protein (CBP; 600140)/p300 (EP300; 602700) and p300/CBP-associated factor (PCAF; 602203) are coactivators for MYOD during myogenic commitment and for MEF2C (600662) during differentiation. Recruitment of these coactivators depends on the presence of steroid receptor coactivators, a family of structurally related and genetically distinct 160-kD molecules, including NCOA1 (SRC1; 602691), NCOA2, and NCOA3 (601937). By Northern blot analysis, Chen et al. (2000) showed that NCOA2 is expressed as a 7.5-kb transcript in both proliferating and confluent myoblasts; expression of NCOA1 and NCOA3 was very low or undetectable. Western blot analysis indicated that the level of NCOA2 protein increases during myogenesis. Immunohistochemistry analysis demonstrated that NCOA2 function is required for expression of MYOG and CDKN1A (116899) and for myogenic differentiation. Reporter assays and mammalian 2-hybrid analysis indicated that the N-terminal bHLH-PAS domain and a C-terminal activation domain (residues 1158 to 1423) of NCOA2 mediate the coactivation of MEF2C-dependent transcription of muscle-specific genes through the MADS box domain of MEF2C. Chen et al. (2000) also found that both the N and C termini of NCOA2 interact with MYOG, supporting a model of cooperative interaction of NCOA2, MYOG, and MEF2C in the regulation of muscle-specific gene expression.

Chen et al. (2002) demonstrated that Carm1 (603934) and Grip1 cooperatively stimulated the activity of Mef2c in mouse mesenchymal stem cells and found that there was direct interaction among Mef2c, Grip1, and Carm1.

Jeong et al. (2007) found that SRC2 regulates murine endometrial function and regulates progesterone-independent and -dependent gene expression. Immunohistochemistry of pregnant mouse uterus showed that SRC2 is expressed in the endometrial luminal and glandular epithelium from pregnancy day 0.5. SRC2 is then expressed in the endometrial stroma on pregnancy day 2.5 to 3.5. Once the embryo is implanted, SRC2 is expressed in the endometrial stromal cells in the secondary decidual zone. The compartmental expression of SRC2 can be mimicked by treatment of ovariectomized mice with estrogen and progesterone. Ablation of SRC2 in the uterus resulted in a significant reduction in the ability of the uterus to undergo a hormonally induced decidual reaction. Microarray analysis of RNA from uteri of wildtype and Src2 -/- mice treated with vehicle or P4 showed that SRC2 was involved in the ability of progesterone to repress specific genes. This microarray analysis also revealed that uteri of Src2 -/- mice showed alterations in genes involved in estrogen receptor (133430), Wnt (see 164820), and bone morphogenetic protein (BMP; see 112264) signaling.

Chopra et al. (2008) identified the transcriptional coactivator SRC2 as a regulator of fasting hepatic glucose release, a function that SRC2 performs by controlling the expression of hepatic G6Pase. SRC2 modulates G6Pase expression directly by acting as a coactivator with the orphan nuclear receptor ROR-alpha (600825). In addition, SRC2 ablation, in both a whole-body and liver-specific manner, resulted in a Von Gierke disease (232200) phenotype in mice. Chopra et al. (2008) concluded that their results positioned SRC2 as a critical regulator of mammalian glucose production. Animal Model.Picard et al. (2002) found that Tif2 -/- mice were protected against obesity and displayed enhanced adaptive thermogenesis, whereas Src1 -/- mice were prone to obesity due to reduced energy expenditure. In white adipose tissue, lack of Tif2 decreased Pparg (601487) activity and reduced fat accumulation, whereas in brown adipose tissue, it facilitated the interaction between Src1 and Pgc1-alpha (604517), which induced the thermogenic activity of Pgc1-alpha. A high-fat diet increased the Tif2/Src1 expression ratio, which may have contributed to weight gain. These results revealed that the relative level of TIF2/SRC1 can modulate energy metabolism.

Gehin et al. (2002) found that Tif2-null mice were viable, but the fertility of both sexes was impaired. Male hypofertility was due to teratozoospermia and age-dependent testicular degeneration. Tif2 also appeared essential for adhesion of Sertoli cells to germ cells. Female hypofertility was due to placental hypoplasia, likely reflecting a requirement for maternal Tif2 in decidua stromal cells facing the developing placenta.

Ye et al. (2005) developed transgenic androgen receptor (AR; 313700)-reporter mice and crossed them with Src1 or Tif2 knockout mice to analyze the contributions of Src1 and Tif2 to AR activity in testis. In vivo imaging and reporter gene assays showed that testicular AR activity was decreased significantly in mice with the Tif2 +/- mutation, but not in those with an Src1 +/- background, suggesting that Tif2 is the preferential coactivator for AR in testis. Immunohistologic analysis confirmed that AR and Tif2 coexist in mouse testicular Sertoli cell nuclei under normal conditions. Although Src1 concentrated in Sertoli cell nuclei in the absence of Tif2, nuclear Src1 did not rescue AR activity in the Tif2 mutant background. Src1 appeared to negatively influence AR activity, whereas Tif2 stimulated AR activity.

Chopra et al. (2008) recognized that absence of Src2 coactivator results in a glycopathy resembling Von Gierke disease in mice. Src2 null mice show fasting hypoglycemia although the animals maintain normal glycemia in the fed state. In mice fasted for 24 hours, plasma analysis demonstrated increased concentration of triglycerides, cholesterol, free fatty acids, and ketone bodies in Src2 null animals. Liver pathology showed a characteristic mosaic pattern like that of patients with glycogen-6 phosphatase deficiency. Periodic acid-Schiff staining, Oil Red O staining, and electron microscopy revealed heavy accumulation of glycogen and triglycerides in the liver of fasted Src2 null animals. Livers of 24-hour fasted Src2 null animals contained about twice as much glycogen and about 3 times as much triglycerides as did livers from wildtype animals. This was accompanied by increased concentrations of circulating glucagon and catecholamine in Src2 null animals, as previously described by Gehin et al. (2002). These mice were also growth restricted. Chopra et al. (2008) found that Src2 and Rora regulate G6Pase without regulating PEPCK and FBP1.