Browse wiki
| Sequence 10 (LZR-20 , LZR20) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Design | SiRNA + |
| Name | LZR-20 , LZR20 + |
| Sequence | siRNA sense (21b) CCTTGATGTTAGATGGAGATT / siRNA antisense (21b) TCTCCATCTAACATCAAGGTT |
| Target | 3D ( HRV-16 ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 1 September 2015 12:18:01 + |
| hide properties that link here |
| No properties link to this page. |
