Browse wiki
Sequence 1006(si 128) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Poly (ADP-ribose) polymerase family, membe … Poly (ADP-ribose) polymerase family, member 1 Ensembl: ENSG00000143799 UniGene: Hs.177766 EntrezGene: 142 Ensembl Chr1: 224615016 - 224662399 Strand: -1 GO terms: 0000723 0003677 0003950 0005515 0005622 0005634 0005635 0005730 0006281 0006284 0006366 0006471 0008270 0016068 0016757 0040009 0042802 0046872 005128768 0016757 0040009 0042802 0046872 0051287 |
Design | SiRNA + |
Name | si_128 + |
Sequence | siRNA sense (21b) GAGAAAUCUCUUACCUCAAGA / siRNA antisense (21b) UUGAGGUAAGAGAUUUCUCGG |
Target | PARP1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:23 + |
hide properties that link here |
No properties link to this page. |