Browse wiki

Jump to: navigation, search
Sequence 104 (CLSTR12038r1 cieg021m05 175)
Application Gene silencing +
Chemistry PmCpmGpmApmTpmGpmApmCpmApmApmGpmGpmTpmTpmTpmCpmCpmTpmCpmCpmApmTpmCpmCpmApmT +
Design Morpholino +
Name CLSTR12038r1_cieg021m05_175  +
Sequence (25b) CGATGACAAGGTTTCCTCCATCCAT
Target AK114973 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:18:14  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-20104-20(CLSTR12038r1-20cieg021m05-20175)"