Browse wiki

Jump to: navigation, search
Sequence 109 (CLSTR07753r1 ciad046i23 151)
Application Gene silencing +
Chemistry PmTpmCpmApmGpmGpmGpmApmApmApmApmCpmApmApmCpmApmGpmCpmCpmApmApmTpmTpmCpmApmT +
Design Morpholino +
Name CLSTR07753r1_ciad046i23_151  +
Sequence (25b) TCAGGGAAAACAACAGCCAATTCAT
Target AK115096 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:18:15  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-20109-20(CLSTR07753r1-20ciad046i23-20151)"