Browse wiki

Jump to: navigation, search
Sequence 554 (ISIS HuASO)
Application Gene silencing +
Chemistry MoC*moT*moC*moA*moG*T*A*A*C*A*T*T*G*A*C*moA*moC*moC*moA*moC +
Description Huntingtin ( Huntington disease ) Ensembl … Huntingtin ( Huntington disease ) Ensembl: ENSG00000197386 UniGene: Hs.518450 EntrezGene: 3064 Ensembl Chr4: 3046206 - 3215485 Strand: 1 GO terms: 0003714 0005215 0005246 0005515 0005625 0005634 0005737 0005794 0006915 0006916 0006917 0007610 0008017 0009405 0009887 0009952 0016023 0016234 0047496 004834187 0009952 0016023 0016234 0047496 0048341
Design MOE gapmer +
Name IONIS HTTRx , ISIS HuASO , ISIS 443139  +
Sequence CTCAGTAACATTGACACCAC
Target HTT ( Homo sapiens ) +
Categories Sequence  +
Modification¬†dateThis property is a special property in this wiki. 9 June 2018 08:44:27  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders