Browse wiki
Sequence 645 (Fomivirsen , Vitravene , ISIS 2922 , ISIS-2922) |
Application | Gene silencing + |
---|---|
Chemistry | G*C*G*T*T*T*G*C*T*C*T*T*C*T*T*C*T*T*G*C*G + |
Description | Human CMV immediate-early 2 |
Design | Phosphorothioate oligonucleotide + |
Name | Fomivirsen , Vitravene , ISIS 2922 , ISIS-2922 + |
Sequence | GCGTTTGCTCTTCTTCTTGCG |
Target | Human CMV immediate-early 2 ( IE2 ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 31 July 2015 09:44:11 + |
hide properties that link here |
No properties link to this page. |