Browse wiki

Jump to: navigation, search
Sequence 645 (Fomivirsen , Vitravene , ISIS 2922 , ISIS-2922)
Application Gene silencing +
Chemistry G*C*G*T*T*T*G*C*T*C*T*T*C*T*T*C*T*T*G*C*G +
Description Human CMV immediate-early 2
Design Phosphorothioate oligonucleotide +
Name Fomivirsen , Vitravene , ISIS 2922 , ISIS-2922  +
Sequence GCGTTTGCTCTTCTTCTTGCG
Target Human CMV immediate-early 2 ( IE2 ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 31 July 2015 09:44:11  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders