Browse wiki
Sequence 672 (siKISS1.1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | KiSS-1 metastasis-suppressor Ensembl: ENSG00000170498 UniGene: Hs.95008 EntrezGene: 3814 |
Design | SiRNA + |
Name | siKISS1.1 + |
Sequence | siRNA sense (21b) GAAATGTTGCGTAACTCAATT / siRNA antisense (21b) TTGAGTTACGCAACATTTCTT |
Target | KISS1 (Homo sapiens) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:53 + |
hide properties that link here |
No properties link to this page. |