Browse wiki

Jump to: navigation, search
Sequence 782 (miR-129 , miR129)
Application Gene silencing +
Chemistry PmApmGpmCpmApmApmGpmCpmCpmCpmApmGpmApmCpmCpmGpmCpmApmApmApmApmApmG +
Description miR129
Design Morpholino +
Name miR-129 , miR129  +
Sequence (22b) AGCAAGCCCAGACCGCAAAAAG
Target MiR-129 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:53  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders