Browse wiki
| Sequence 971 (NP-231 , NP231) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Design | SiRNA + |
| Name | NP-231 , NP231 + |
| Sequence | siRNA sense (21b) TAGAGAGAATGGTGCTCTCTT / siRNA antisense (21b) GAGAGCACCATTCTCTCTATT |
| Target | NP gene ( AY790292.1 ) ( Influenza A virus (A / swine / Korea / S175 / 2004( H1N1 )) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:53 + |
| hide properties that link here |
| No properties link to this page. |
