Browse wiki

Jump to: navigation, search
Sequence 1002(DJ-M2 , DJM2)
Application Gene silencing +
Chemistry RNA +
Description Parkinson disease ( autosomal recessive, early onset ) 7 Ensembl: ENSG00000116288 UniGene: Hs.419640 EntrezGene: 11315 Ensembl Chr1: 7944310 - 7967926 Strand: 1 GO terms: 0005515 0005634 0005737 0006457 0007265 0008344 0042542 0051585
Design SiRNA +
Name DJ-M2 , DJM2  +
Sequence siRNA sense (21b) TGGAGACGGAGATCCCTGTTT / siRNA antisense (21b) ACAGGGATCTCCGTCTCCATT
Target PARK7 ( Homo sapiens ) +
Categories Sequence  +
Modification┬ádateThis property is a special property in this wiki. 2 March 2015 02:21:02  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders