Browse wiki

Jump to: navigation, search
Sequence 1004(si 126)
Application Gene silencing +
Chemistry RNA +
Description Poly (ADP-ribose) polymerase family, membe … Poly (ADP-ribose) polymerase family, member 1 Ensembl: ENSG00000143799 UniGene: Hs.177766 EntrezGene: 142 Ensembl Chr1: 224615016 - 224662399 Strand: -1 GO terms: 0000723 0003677 0003950 0005515 0005622 0005634 0005635 0005730 0006281 0006284 0006366 0006471 0008270 0016068 0016757 0040009 0042802 0046872 005128768 0016757 0040009 0042802 0046872 0051287
Design SiRNA +
Name si_126  +
Sequence siRNA sense (21b) CAGGCUGCUUUGUCAAGAACA / siRNA antisense (21b) UUCUUGACAAAGCAGCCUGGA
Target PARP1 ( Homo sapiens ) +
Categories Sequence  +
Modification¬†dateThis property is a special property in this wiki. 2 March 2015 02:20:53  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders