Browse wiki
| Sequence 1017(siPIK3C2A.1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Phosphoinositide-3-kinase, class 2, alpha polypeptide Ensembl: ENSG00000011405 |
| Design | SiRNA + |
| Name | siPIK3C2A.1 + |
| Sequence | siRNA sense (21b) CCCACTAATTGCATTGGAATT / siRNA antisense (21b) TTCCAATGCAATTAGTGGGTA |
| Target | PIK3C2A (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:01 + |
| hide properties that link here |
| No properties link to this page. |
