Browse wiki
| Sequence 1020(Perilipin) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Perilipin Ensembl: ENSG00000166819 UniGene: Hs.103253 , Hs.697349 EntrezGene: 5346 Ensembl Chr15: 88008607 - 88023595 Strand: -1 GO terms: 0005515 0005811 0008289 0016042 |
| Design | Primer set + |
| Name | Perilipin + |
| Sequence | Forward PCR primer (20b) GCCATGTCCCTATCAGATGC / Reverse PCR primer (20b) GTTGTCGATGTCCCGGAATT |
| Target | PLIN1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:46 + |
| hide properties that link here |
| No properties link to this page. |
