Browse wiki
| Sequence 1022(TIP47) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Mannose-6-phosphate receptor binding protein 1 Ensembl: ENSG00000105355 UniGene: Hs.140452 EntrezGene: 10226 Ensembl Chr19: 4789346 - 4818676 Strand: -1 GO terms: 0005737 0005768 0005794 0016020 0016192 |
| Design | Primer set + |
| Name | TIP47 + |
| Sequence | Forward PCR primer (20b) GCTGGACAAGTTGGAGGAGA / Reverse PCR primer (20b) CCGACACCTTAGACGACACA |
| Target | PLIN3 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:10 + |
| hide properties that link here |
| No properties link to this page. |
