Browse wiki
| Sequence 1023(S3-12) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Perilipin 4 Ensembl: ENSG00000167676 UniGene: Hs.591387 EntrezGene: 29393 Ensembl Chr19: 4455471 - 4464704 Strand: -1 GO terms: 0005515 0005524 0005886 0044267 |
| Design | Primer set + |
| Name | S3-12 + |
| Sequence | Forward PCR primer (21b) ACATCTTCCACCCCATGAATG / Reverse PCR primer (18b) GTGTTCAAATGCCCGCTG |
| Target | PLIN4 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:08 + |
| hide properties that link here |
| No properties link to this page. |
