Browse wiki
| Sequence 1029(siPLK1.1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Polo-like kinase 1 (Drosophila) Ensembl: … Polo-like kinase 1 (Drosophila) Ensembl: ENSG00000166851 UniGene: Hs.592049 EntrezGene: 5347 Ensembl Chr16: 23597702 - 23609189 Strand: 1 GO terms: 0000074 0000166 0004672 0004674 0004713 0005515 0005524 0005634 0005813 0006468 0006813 0007067 0008283 0015272 0016020 001674013 0007067 0008283 0015272 0016020 0016740 |
| Design | SiRNA + |
| Name | siPLK1.1 + |
| Sequence | siRNA sense (21b) GGATCAAGAAGAATGAATATT / siRNA antisense (21b) TATTCATTCTTCTTGATCCGG |
| Target | PLK1 (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:56 + |
| hide properties that link here |
| No properties link to this page. |
