Browse wiki

Jump to: navigation, search
Sequence 1030(siPLK1.2)
Application Gene silencing +
Chemistry RNA +
Description Polo-like kinase 1 (Drosophila) Ensembl: … Polo-like kinase 1 (Drosophila) Ensembl: ENSG00000166851 UniGene: Hs.592049 EntrezGene: 5347 Ensembl Chr16: 23597702 - 23609189 Strand: 1 GO terms: 0000074 0000166 0004672 0004674 0004713 0005515 0005524 0005634 0005813 0006468 0006813 0007067 0008283 0015272 0016020 001674013 0007067 0008283 0015272 0016020 0016740
Design SiRNA +
Name siPLK1.2  +
Sequence siRNA sense (21b) CCATATGAATTGTACAGAATT / siRNA antisense (21b) TTCTGTACAATTCATATGGTG
Target PLK1 (Homo sapiens) +
Categories Sequence  +
Modification¬†dateThis property is a special property in this wiki. 2 March 2015 02:20:47  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders