Browse wiki
Sequence 1032(hmA1-6 , hmA16) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Polymerase ( DNA directed ), beta Ensembl … Polymerase ( DNA directed ), beta Ensembl: ENSMUSG00000031536 UniGene: Mm.123211 EntrezGene: 18970 Ensembl Chr8: 23738604 - 23763897 Strand: -1 GO terms: 0000287 0000795 0003677 0003684 0003824 0003887 0003890 0003912 0005622 0005634 0005737 0005876 0006260 0006281 0006287 0006290 0006916 0008017 0008219 0016740 0016829 0017125 003140217 0008219 0016740 0016829 0017125 0031402 |
Design | SiRNA + |
Name | hmA1-6 , hmA16 + |
Sequence | siRNA sense (21b) CTTTGGTGGTGGTCGTGGATT / siRNA antisense (21b) TCCACGACCACCACCAAAGTT |
Target | Polb ( Mus musculus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:12 + |
hide properties that link here |
No properties link to this page. |