Browse wiki
| Sequence 1033(hmA1-M6 , hmA1M6) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Polymerase ( DNA directed ), beta Ensembl … Polymerase ( DNA directed ), beta Ensembl: ENSMUSG00000031536 UniGene: Mm.123211 EntrezGene: 18970 Ensembl Chr8: 23738604 - 23763897 Strand: -1 GO terms: 0000287 0000795 0003677 0003684 0003824 0003887 0003890 0003912 0005622 0005634 0005737 0005876 0006260 0006281 0006287 0006290 0006916 0008017 0008219 0016740 0016829 0017125 003140217 0008219 0016740 0016829 0017125 0031402 |
| Design | SiRNA + |
| Name | hmA1-M6 , hmA1M6 + |
| Sequence | siRNA sense (21b) CTTTGGTGTGGGTCGTGGATT / siRNA antisense (21b) TCCACGACCCACACCAAAGTT |
| Target | Polb ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:05 + |
| hide properties that link here |
| No properties link to this page. |
