Browse wiki
Sequence 1037(CypB) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Peptidylprolyl isomerase B ( cyclophilin B ) Ensembl: ENSG00000166794 UniGene: Hs.434937 EntrezGene: 5479 |
Design | SiRNA + |
Name | CypB + |
Sequence | siRNA sense (21b) GGTGGAGAGCACCAAGACATT / siRNA antisense (21b) TGTCTTGGTGCTCTCCACCTT |
Target | PPIB ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:20 + |
hide properties that link here |
No properties link to this page. |