Browse wiki
| Sequence 1038(PRDM2i-1853 , PRDM2i1853) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | PR domain containing 2, with ZNF domain Ensembl: ENSG00000116731 UniGene: Hs.371823 EntrezGene: 7799 Ensembl Chr1: 13899322 - 14024162 Strand: 1 GO terms: 0003676 0003677 0003700 0005622 0005634 0006355 0008270 0030528 0045449 0046872 |
| Design | SiRNA + |
| Name | PRDM2i-1853 , PRDM2i1853 + |
| Sequence | siRNA sense (21b) GACTGCTCAGAGGTAACACTT / siRNA antisense (21b) GTGTTACCTCTGAGCAGTCTT |
| Target | PRDM2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:25 + |
| hide properties that link here |
| No properties link to this page. |
