Browse wiki
| Sequence 1046(PEN-2 , PEN2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Presenilin enhancer 2 homolog ( C. elegans ) Ensembl: ENSG00000205155 UniGene: Hs.534465 EntrezGene: 55851 Ensembl Chr19: 40928334 - 40929743 Strand: 1 GO terms: 0005515 0005783 0005794 0005887 0006509 0007220 0016020 0016485 0042987 0043085 |
| Design | SiRNA + |
| Name | PEN-2 , PEN2 + |
| Sequence | siRNA sense (21b) TCAAAGGCTATGTCTGGCGTT / siRNA antisense (21b) CGCCAGACATAGCCTTTGATT |
| Target | PSENEN ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:58 + |
| hide properties that link here |
| No properties link to this page. |
