Browse wiki
Sequence 1050(cOff-track , cOfftrack) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | PTK7 protein tyrosine kinase 7 Ensembl: E … PTK7 protein tyrosine kinase 7 Ensembl: ENSG00000112655 UniGene: Hs.90572 EntrezGene: 5754 Ensembl Chr6: 43152007 - 43237435 Strand: 1 GO terms: 0001843 0004672 0004674 0004713 0004714 0004872 0005021 0005515 0005524 0005887 0006468 0007155 0007165 0016020 0016021 004519868 0007155 0007165 0016020 0016021 0045198 |
Design | SiRNA + |
Name | cOff-track , cOfftrack + |
Sequence | siRNA sense (21b) GAACGAAGAGGCCATGTTTTT / siRNA antisense (21b) AAACATGGCCTCTTCGTTCTT |
Target | PTK7 ( Gallus gallus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:26 + |
hide properties that link here |
No properties link to this page. |