Browse wiki

Jump to: navigation, search
Sequence 1051(rab11a 1)
Application Gene silencing +
Chemistry RNA +
Design ShRNA +
Name rab11a_1  +
Sequence (70b) AGATCTCCGGCACAGATATGGGACACATTCAAGAGATGTGTCCCATATCTGTGCCTTTTTGGAAAAGCTT
Target RAB11A ( Canis lupus familiaris ) +
Categories Sequence  +
Modification┬ádateThis property is a special property in this wiki. 2 March 2015 02:21:21  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders