Browse wiki
| Sequence 1052(ATRIR 2 , ATRIR2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | RAB11B, member RAS oncogene family Ensembl: ENSG00000141934 |
| Design | SiRNA + |
| Name | ATRIR_2 , ATRIR2 + |
| Sequence | siRNA sense (21b) AGAGGAACAGAGAAGATCACA / siRNA antisense (21b) TGATCTTCTCTGTTCCTCTTT |
| Target | RAB11B ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:51 + |
| hide properties that link here |
| No properties link to this page. |
