Browse wiki

Jump to: navigation, search
Sequence 1055(RAB12)
Application Gene expression +
Chemistry DNA +
Description RAB12, member RAS oncogene family EnsemblRAB12, member RAS oncogene family Ensembl: ENSG00000206418 UniGene: Hs.270074 EntrezGene: 201475 Ensembl Chr18: 8599443 - 8629380 Strand: 1 GO terms: 0000166 0003777 0003924 0005515 0005524 0005525 0005622 0005794 0005875 0006886 0006913 0007018 0007165 0007264 0015031 001602013 0007018 0007165 0007264 0015031 0016020
Design Primer set +
Name RAB12  +
Sequence Forward PCR primer (20b) TGCGGTTCTGTGAAGCAAGT / Reverse PCR primer (20b) CAACAGCATCGGACATGTGG
Target RAB12 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:07  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders