Browse wiki
| Sequence 1059(Raldh2-2 , Raldh22) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Design | SiRNA + |
| Name | Raldh2-2 , Raldh22 + |
| Sequence | siRNA sense (21b) TACAACAAGATCTTGGAACTT / siRNA antisense (21b) GTTCCAAGATCTTGTTGTATT |
| Target | Raldh2 ( Gallus gallus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:15 + |
| hide properties that link here |
| No properties link to this page. |
