Browse wiki

Jump to: navigation, search
Sequence 1061(RasGRP1-RNAi363 , RasGRP1RNAi363)
Application Gene silencing +
Chemistry RNA +
Description RAS guanyl releasing protein 1 ( calcium aRAS guanyl releasing protein 1 ( calcium and DAG-regulated ) Ensembl: ENSG00000172575 UniGene: Hs.591127 EntrezGene: 10125 Ensembl Chr15: 36567590 - 36644224 Strand: -1 GO terms: 0005085 0005088 0005509 0005515 0005622 0005624 0007242 0007264 0007265 0008270 0008289 005105642 0007264 0007265 0008270 0008289 0051056
Design ShRNA +
Name RasGRP1-RNAi363 , RasGRP1RNAi363  +
Sequence (63b) GATCCCTTCACCAGGACTTTGCCTGTTCAAGAGACAGGCAAAGTCCTGGTGAATTTTTGGAAA
Target RASGRP1 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:17  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders