Browse wiki
| Sequence 1075(RbAp48) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Retinoblastoma binding protein 4 Ensembl: ENSG00000162521 UniGene: Hs.647652 EntrezGene: 5928 Ensembl Chr1: 32889411 - 32918845 Strand: 1 GO terms: 0005515 0005634 0006260 0006338 0006350 0006355 0007049 0008094 0008285 0016581 |
| Design | SiRNA + |
| Name | RbAp48 + |
| Sequence | siRNA sense (21b) GCCACTCAGTTGATGCTCATT / siRNA antisense (21b) TGAGCATCAACTGAGTGGCTT |
| Target | RBBP4 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:13 + |
| hide properties that link here |
| No properties link to this page. |
