Browse wiki
| Sequence 1076(RbAp46) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Retinoblastoma binding protein 7 Ensembl: ENSG00000102054 UniGene: Hs.495755 EntrezGene: 5931 Ensembl ChrX: 16772385 - 16798386 Strand: -1 GO terms: 0005515 0005634 0006260 0006350 0006355 0007275 0008283 0016568 |
| Design | SiRNA + |
| Name | RbAp46 + |
| Sequence | siRNA sense (21b) GGAGAAGTAAACCGTGCTCTT / siRNA antisense (21b) GAGCACGGTTTACTTCTCCTT |
| Target | RBBP7 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:20 + |
| hide properties that link here |
| No properties link to this page. |
