Browse wiki

Jump to: navigation, search
Sequence 107 (CLSTR04831r1 cilv015k10 116)
Application Gene silencing +
Chemistry PmCpmApmGpmCpmApmGpmApmApmApmApmApmCpmApmTpmTpmTpmCpmCpmApmApmGpmApmCpmApmT +
Design Morpholino +
Name CLSTR04831r1_cilv015k10_116  +
Sequence (25b) CAGCAGAAAAACATTTCCAAGACAT
Target AK115073 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:05  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence_107_(CLSTR04831r1_cilv015k10_116)"