Browse wiki
Sequence 1085(DBC2-a , DBC2a) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Rho-related BTB domain containing 2 Ensembl: ENSG00000008853 UniGene: Hs.372688 EntrezGene: 23221 Ensembl Chr8: 22913059 - 22933655 Strand: 1 GO terms: 0000166 0003677 0003700 0005515 0005525 0005622 0005634 0007264 0007275 0015031 |
Design | SiRNA + |
Name | DBC2-a , DBC2a + |
Sequence | siRNA sense (21b) GAGATGGCAGAAGATCCTCTT / siRNA antisense (21b) GAGGATCTTCTGCCATCTCTT |
Target | RHOBTB2 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:13 + |
hide properties that link here |
No properties link to this page. |