Browse wiki
| Sequence 1086(DBC2-b , DBC2b) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Rho-related BTB domain containing 2 Ensembl: ENSG00000008853 UniGene: Hs.372688 EntrezGene: 23221 Ensembl Chr8: 22913059 - 22933655 Strand: 1 GO terms: 0000166 0003677 0003700 0005515 0005525 0005622 0005634 0007264 0007275 0015031 |
| Design | SiRNA + |
| Name | DBC2-b , DBC2b + |
| Sequence | siRNA sense (21b) CCAGGAGTATTTCGAGAAGTT / siRNA antisense (21b) CTTCTCGAAATACTCCTGGTT |
| Target | RHOBTB2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:03 + |
| hide properties that link here |
| No properties link to this page. |
